How Hurricanes Impact Natural Selection

Many of us are familiar with hurricanes and the disaster they cause. This last season brought some of the worst storms ever seen, and the trend indicates more will be coming.

Not only should we be concerned with the devastation this will have on the human population, but we must turn our attention to other species as well.

So when you see this video, don’t be so surprised.

Yes, that’s right. For the sole purpose of science, researchers put lizards on a leaf blower and tried to kick them off. Turns out they are pretty good at riding along.

But, why would scientists torture innocent lizards?

Well, they really didn’t. As it seems, lizards are remarkably talented at staying put when necessary, even during high force wind events, such as a hurricane. Scientists had an incredibly hard time knocking the lizards off (and if they did fall off, there was padding in place to keep them safe).

Biologist Colin Donihue, after recently visiting small islands in the Caribbean and studying the anole lizard, was given a remarkable opportunity.

Not long after his team’s departure, two hurricanes hit the islands, both with wind speeds clocked above 200 kilometers per hour.

The team returned as soon as the coast was clear, and examined the lizards present immediately after the devastating storms.

What they found was interesting. After a quick examination, it was noted that the lizards most present after the storm had larger toepads, longer forelimbs, and shorter hind limbs than what was measured before the storm.

This gave the team from Harvard an idea. Could they replicate a hurricane like experience under a controlled setting and actually show if these traits are favorable? Since I have already shown you the video…. the answer is yes, they could.

Image result for toe pads of lizards
An example of a toepad belonging to a lizard (gecko in this case). Source

It is thought that these traits allow lizards who live in such a climate to latch onto branches in small bushes and hold on for dear life until the storm has passed.

What makes this particular study so unique, is the chance to study a population before a large event, and immediately after. The scientists were able to directly measure the difference between the species and discover what sort of traits enhanced survival. This allows a direct measurement of natural selection, the idea of how evolution works.

While there many other possibilities besides a hurricane that could drive a lizard to have larger toepads or shorter hind limbs, the natural selection process is still present.

More importantly, this small study could provide a glance into how climate change affects species. With the heating of the oceans due to astronomically high temperatures, weather patterns change dramatically. This includes the frequency of large scale storms such as hurricanes.

With hurricanes becoming more common in the tropical areas, such as the Caribbean, this forces animals such as the anol lizard to either adapt or suffer. While it seems this remarkable lizard has developed a method to out ride the storms, and probably give them a severe advantage at rodeos if given the chance, much yet is to be discovered as to how well species adapt with the increasing temperatures, ocean acidification, and frequency of severe weather patterns.

 

Thank you for reading this fun, quick blog!

If you have any questions, comments, concerns, or suggestions, please email us directly or post a comment below. You can also reach out to us on Facebook and Twitter.

And as always, be curious and stay mindful!

 

Sources:

  1. https://www.nature.com/articles/s41586-018-0352-3
  2. https://www.nature.com/articles/d41586-018-05821-7
  3. https://www.nature.com/articles/d41586-018-05822-6 (original video source)
  4. Featured Image- https://www.youtube.com/watch?v=Dx3xgSBjbzk

 

 

 

Advertisements

The Benefits of the Daily Probiotic

While browsing through my science news items this morning, I came across an article discussing the effects probiotics have on heart health. Seeing as I haven’t yet discussed probiotics on this blog, I thought this would make a good opportunity.

The article was published in Authority Nutrition. Within there are many citations, and appears to be evidence based, but does the evidence actually support the claim? Turns out not really.

Probiotics: A review

Before I get into the article, I want to make sure everyone is on the same page when it comes to probiotics.

The definition of probiotic is officially described as: denoting a substance that stimulates the growth of microorganisms, especially those with beneficial properties (such as those of the intestinal flora)

Before researching for this post, I was under the impression probiotics were a recent invention (within the last few decades) and was surprised to find that the idea is much older.

The hypothesis that your gut microbiome (the good bacteria living within your gut) could be altered was first coined by Russian scientist and Nobel laureate Élie Metchnikoff, who in 1907 believed that aging was caused by bad bacteria that excreted harmful substances into the gut. These toxic molecules then act on the body and cause characteristics of old age.

Élie Metchnikoff

After witnessing that certain European countries who drank milk fermented by lactic-acid bacteria had relatively long healthy lives, Metchnikoff decided to incorporate the sour milk into his diet. Soon afterwards he had convinced many of his colleagues, and doctors were prescribing sour milk to treat various ailments.

After the initial sour milk product, many foods have been developed and labelled through the decades as a probiotic; including yogurt, buttermilk, kombucha fermented tea, and sauerkraut.

Recently, probiotics have gained momentum with the release of probiotic pill captures, or fermented drinks (such as kombucha) containing what is believed to be good bacteria meant to alter your gut flora and cure a plethora of diseases.

And the data suggests that the usage of probiotics has increased with the release of these new products. Data from the 2012 National Health Interview Survey show about 4 million U.S. adults use or have used a probiotic.

Nowadays, you can’t enter a grocery store without seeing 10 different brands of probiotics, all promising to cure disease or maintain gut microbiome diversity.

The Science Behind Probiotics:

Image result for microbiome
Source

When you type in the keyword probiotic into PubMed, 18,605 results are returned, with an exponential growth starting in the early 2000’s. However, much of the data coming out suggests probiotics are not as beneficial as companies would have you believe (as always).

Much research has been preformed discussing what scientists call the microbiome (the variety of bacteria that exist within us or on us , primarily referring to the intestine and skin.

Evidence suggests that an unhealthy microbiome with the wrong type of bacteria, or too little of good bacteria can contribute to many health defects. Those with disrupted microbiota can experience digestive tract issues, and possibly have an increased risk of developing heart disease, diabetes, weight gain, and many other medical issues. While the evidence is young, there does appear to be a link with the gut microbiome and many diseases we fight today.

Recent mice studies further confirm this hypothesis. Unhealthy mice who receive a microbiome replacement with the microbiome of another healthy mouse, under go a great change. One example shows that mice who are typically more afraid (hide, don’t jump from ledges, etc..) and get their microbiome replaced with mice who are more courageous, appear to become more brave. Other studies have shown that normal mice who get a microbiome replacement with obese mice end up actually gaining weight to similar levels as the original obese mouse.

This preliminary data needs to be further evaluated, but it does bring forward an interesting discussion of how microbiomes make up our human personality.

And so, probiotics on the surface have the potential to modify our microbiome and increase the health of those who take them by replacing them with beneficial bacteria. It seems that probiotics have in general two types of bacteria; Lactobacillus and Bifidobacterium.

However, these probiotics have mixed effects when it comes to the claims companies promote. In short, they are not the miracle cure.

Probiotics have been shown to relieve symptoms of certain medical ailments, such as inflammatory bowel disease, irritable bowel syndrome, or diarrhea caused by antibiotics. These however have not been conclusively tested, and much more work needs to be completed before we can actually consider probiotics a valid treatment.

What does seem to be clear though, is that if you are not suffering from a true, diagnosed medical disease, there is little or no benefit of taking probiotics. So don’t think of probiotics as something everyone should be taking. And if you have a compromised immune system for whatever reason, there is a risk of developing infections. Therefore, it is best to avoid probiotics.

Probiotics Contributing to Healthy Hearts:

Image result for microbiome heart
Source

Getting back to the article I initially found today, what I found was even more suspicious evidence suggesting probiotics are able to prevent heart disease and lower cholesterol.

The article is titled “Do Probiotics Benefit Heart Health?” and is on the surface a well cited article with what appears to be good information. The news item covers several review meta-articles that  suggest probiotics decrease your cholesterol, your blood pressure, inflammation, and triglycerides.

However, after checking the sources my suspicions were confirmed.

Several review articles were cited, each being a meta-analysis of multiple studies involving human subjects. Almost all of which seemed to be double blind, placebo control studies. And there does appear to be at least some interesting data. However, these articles to the best of my knowledge are not using commercially available probiotics. In fact, I had a difficult time trying to find out exactly how much bacteria was added, and how it compares to those on the market.

In addition, I also found articles published in journals such as BMC Complimentary and Alternative Medicine that publish articles supporting traditional Chinese medicine (in children I might add), acupuncture, and other pseudo-scientific methods. This suggests to me the “peer review” of these journals may not stand up to the standards of evidenced based articles.

Being as probiotics are a drug, you would expect to find any evaluation of the proper dosage and potential toxicity (in this case probably likelihood of infection), but I found none.

All in all, the evidence provided by this news item does not impress me. It is impossible to prove anything in science, but these articles to me fall extremely short of suggesting probiotics contribute to lowering cholesterol or cure heart disease. The news items does not explicitly say that probiotics are the miracle cure, but I don’t believe it leaves the viewer with an accurate statement of the current research, and is not as evidence based as it suggests. There was however one true statement in the news item. Every article mentioned used patients either with high cholesterol, high BP, or high triglycerides. Therefore we cannot make the claim probiotics prevent high cholesterol or high BP

Takeaways:

So far, I cannot conclusively say probiotics are completely useless. There does seem to be preliminary evidence suggesting benefits to those with medically diagnosed diseases, and the evidence of reducing cholesterol levels and preventing heart disease is shaky at best.

There seems to be no evidence suggesting it should be taken for normal healthy individuals, and there is too much discrepancies between the companies to suggest all of them work the same. If indeed there is a benefit towards ingesting one type of bacteria, the probiotic industry needs to police themselves and use the proper amount and type of bacteria shown to be clinically effective. There is very little evidence on safety of probiotics, and little evidence on efficacy over long periods of time.

To wrap up, until more evidence is released showing probiotics are more effective, and the probiotics are controlled by an agency responsible for developing them safely, stay clear of probiotics.

Thank you for reading. I hope you learned something. I know I did.

If you have any comments, suggestions, or sources you would like to share with me, please do not hesitate to leave a comment below. You can always email us at copernicuscalledblog@gmail.com, or find us on Facebook and Twitter.

As always, remember to stay curious, and be mindful!

 

 Please note that is article is not intended to be medical advice. If you are struggling with a medical disease, please refer to a physician for proper advice and treatment.

Sources:

  1. https://www.healthline.com/nutrition/probiotics-and-heart-health
  2. https://en.wikipedia.org/wiki/Probiotic
  3. Arteriosclerosis and intestinal poisons. [a contemporary review of Metchnikoff’s work] JAMA1910, 55:2311-12.
  4. https://nccih.nih.gov/health/probiotics/introduction.htm
  5. Featured Image Credit: https://benefitsofprobiotics.com/probiotic-supplements-gut-health/

 

 

 

 

 

 

How A Journalist Overestimated the power of One Sitcom in Society.

Recently, I found an article published on Medium describing how the 1990’s sitcom Friends is responsible for the “downfall of western civilization.”

The whole article seemed to be just a little over the top, so I decided to give a thorough reply on this blog page.

In case you have not seen the article I am referring too, follow this link to give it the quick once over.

And if you are like me, you  were alive in the 1990’s and early 2000’s and you probably owned a TV set. While many other shows were popular during the 1990’s, it’s really hard to ignore the show Friends, a comedy sitcom focused around six quirky friends struggling to establish their lives in New York City.

One of the main characters, Ross Geller, is a scientist.  More specifically, he is a paleontologist who begins the show working at a museum, and later ends up as a professor at a prestigious university.

Throughout the whole series, a whopping 10 seasons, Ross is constantly picked on for his profession and is largely ignored by his friends when discussing his work. These exchanges constantly get a laughter from the studio audience.

David Hopkins, the man behind the original article, claims that this visualization of “picking on the smart people” is what caused the downfall of our civilization and likely contributed to the scientific illiteracy we see in today’s society.

“Yes, my theory is that Friends may have triggered the downfall of western civilization. You might think I’m crazy. But to quote Ross: ‘Oh, am I? Am I? Am I out of my mind? Am I losing my senses?” ”

-David Hopkins, “How a TV Sitcom Triggered the Downfall of Western Civilization.”

I think that is a gross exaggeration. And let me describe to you why.

 

Friends is not the first and not even the worst:

Maybe intellectuals have always been persecuted and shoved in lockers, but something in my gut tells me we’re at a low point — where social media interaction has replaced genuine debate and political discourse, where politicians are judged by whether we’d want to have a beer with them, where scientific consensus is rejected, where scientific research is underfunded, where journalism is drowning in celebrity gossip.”

-David Hopkins, “How a TV Sitcom Triggered the Downfall of Western Civilization.”

The largest issue I see with Mr. Hopkins complaint, is that Friends is not the first show to have a scientific/nerdy guy who was picked on during the show. Do we all remember the show Cheers? I admit, it’s a little old for my generation, but I have seen the show in it’s entirety and this show has two main characters similar to Ross that are ostracized for their intelligence. Anybody remember Diane Chambers, who was constantly picked on the gang at Cheers for her fascination with classical books, plays, and overall interest in learning? Or perhaps Fraiser Crane, the psychologist who was a bore for basically the first two seasons of the show until he became a regular who drank more than he treated patients (and let’s not forget his wife Lillith).

Now sure, Fraiser ended up receiving his own show, but even on his own show him and his brother Niles are picked on constantly for their intelligence and love of the finer things. And let’s not forget the dozens of other shows that constantly bully geeks, nerds, and dorks on mainstream television. Steve Urkel on Family Matters? Lisa Simpson or Milhouse Van Houten on The Simpsons? Carlton on The Fresh Prince of Bel-Air? All of these characters came before Ross was a twinkle in the producer’s eye that invented the character. If anything, the character Ross added to the description of nerds in mainstream media, and was likely developed to be similar to other nerds on other TV shows.

Ross was not alone in his suffering:

 Sure Ross was picked on. Quite a bit actually. But he was not the only main character in the hot seat. Basically every single character was picked on religiously throughout the show. Joey Tribbiani, the lovable aspiring actor, was constantly bullied for his stupidity and by the end of the series was even written to be almost to stupid to be real. Monica was continuously made fun of her obsessive cleaning and organized personality. Chandler, the sarcastic one, was picked on not only for having a job no one could remember, and everyone thought he was secretly gay. The fact of the matter is, at the end of the day every character, even the small characters like Gunther, were picked on for their personality an equal amount. And at the end of the day, it was the diversity of the group that made the group fit so well together. If we want to specifically say Ross’s character contributed to scientific illiteracy or high point in bullying nerds, I think we would learn more evaluating the community as a whole.

2004, a year with coincidences:

Sure it does seem like the end of Friend’s marked the beginning of scientific devastation in our civilization, but it’s really all a coincidence. It’s not good science to automatically correlate events happening within a year together. In 2004, Mr. Hopkins was a teacher who constantly saw bullying of nerds, President Bush was elected for a second term, Paris Hilton was a big deal, etc…..

But what does this really show us? It’s easy to look at any information from one year and make some random conclusion.

For example: I randomly choose the year 1998.

Google was born. Bill Clinton denies he had sexual relations with that woman, and a huge financial crisis hits a large portion of Asia.

Conclusions? Bill Clinton’s lies caused Google to form to prove him wrong, and this causes a financial crisis in Asia.

Now I know this is ridiculous, And I spent about 30 seconds writing that to be as ridiculous as possible, because there is no good reason to look at any year and try to piece information together. Correlation does not always correspond to causation. 

If you look at any year in particular, you can probably fit any narrative you wish to defend your claim, and that is not the purpose of good science. Scientists spend time objectively spending time looking for trends, and then try to find an explanation for them. More importantly they look for other explanations to explain the phenomenon besides their own theories.

 

And finally to sum up my main issue with this whole idea, why should we put all the blame on TV shows? Sure we all watch TV and that has an impact on our lives, but WE are the ones choosing what to watch. If there is anyone to blame, it is ourselves for watching American Idol or The Bachelor over The Discovery Channel and National Geographic. Rather than putting actors and musicians on the pedestal, we should put scientists and inventors in the public eye. We should inherently be more interested in news items that expand our knowledge rather than the celebrity gossip. And this has been a problem looooong before 2004. Just as we shouldn’t blame video games on increasing school shootings, we shouldn’t blame TV for stupefying civilization, we should blame ourselves.

So Mr. Hopkins, I think we are trying to say the same thing. But this issue is much larger than one sitcom. It’s the society in general.

And here are the suggestions I have to improve our society.

Think Critically: 

Stop believing everything people tell you. Question as much as you possibly can. Even your professors or teachers, because more than likely they are wrong about something (not always on purpose).

Don’t Enter an Echo Chamber: 

It is extremely easy on the internet to find sources that on the surface appear legit, but below end up being complete garbage. If you are looking to prove something you believe in, don’t just look for sites that confirm your suspicion. Spend just as much time looking at the other side of the argument and hear what they have to say. If you spend your whole life only reading articles that support your belief system, you are entering into an echo chamber that can in the long run harm the knowledge you have developed.

Be Willing to Change your Opinion:

People are wrong all the time, myself especially. And this is extremely hard to get used to, but stop being bothered by being wrong. It happens. Rather than digging yourself into a faulty belief, say “Oh yeah, I am wrong, I need to change my opinion.” There is absolutely nothing wrong with that.

Dear God Yes Read a Book: 

Mr. Hopkins said it well. Reading a book rather than watching TV is a great way to expand your knowledge, whether it’s fiction or non-fiction. Read books that question your deepest belief system. You cannot limit your books to your safety zone, it is much more harmful than it is helpful.

Have a Scout Mindset: 

I think it’s safe to say that all of us are curious. But some of us inherently are more curious or more interested in feeding our curiosity than others. So the next time you wonder why the sky is blue, don’t just think about it for 30 seconds, look it up. If you can’t find an answer that makes sense, keep digging until it does make sense. You will learn so much. Basically look for THE answer, not YOUR answer.

P.S. If you do not know what a scout mindset is, check out this wonderful Ted Talk.

So the next time you binge watch Friends on Netflix, don’t feel so bad for Ross.

 

 

 

 

 

 

 

Learning About Exoplanets

For generations, people have always wondered what life might exist in the universe besides ours. It has become a hot topic in movies, books, and of course, science.

Before even reaching space, humans have always hypothesized about “The Great Beyond” So far we have not found alternative life, but we have made significant progress. 

On major discovery is exoplanets. It seems pretty obvious that extraterrestrial life must exist on another planet, however before we can find life, we must find planets that can support it. 

An exoplanet by definition is a planet outside our solar system that orbits a star(1). The first scientific detection of an exoplanet was in 1988, although we have hypothesized the existence of exoplanets for over 100 years. 

Although we know have the technology to find exoplanets semi-regularly (the current number of known planets is almost 4,000), scientists are looking for planets in what is called the habitable zone (also called the Goldilocks zone). This arbitrary zone describes planets that are just far enough from their sun to support liquid water, but not too far to cause it to freeze. 

1920px-Diagram_of_different_habitable_zone_regions_by_Chester_Harman
An example of the habitable zone and a few exoplanets that exist within a habitable zone. Source

Of course, it takes more than possessing water to host life on a planet. Since, we only have one example to go off of, scientists are looking for planets most similar to our own. As of now there is an estimated 40 billion planets Earth-sized and orbiting the habitable zone of stars we have yet to discover(2). It’s these planets that we are most interested in.

In fact, recently a group of scientists met and explained how water should not be the only candidate for a planet within the habitable zone able to host liquid water. Certain geological structures are necessary to allow growth of organisms and proper collection of minerals that can give life a better chance (4).

With new discoveries and scientific advancements, researchers are also trying to unravel the mysteries of exoplanet geology. 

The research even has a name. Exogeology. This area brings together scientists from the field of astronomy, planetary scientists, and geologists together with the task to reveal what exoplanets look like from a geological perspective(3).

One of the best tools we have to decipher exoplanet surfaces, called the Z machine, has just begun scratching the surface in exploring exoplanet material. 

This machine is currently the largest high frequency electromagnetic wave generator, and its purpose within this context is to test various materials under extreme temperature and pressure  (5).

While we are not able to travel to exoplanets yet, we are now working to understand them as best as possible by working to create artificial environments we would normally see to try and discern how exoplanets behave.  

With more information, we can better understand exoplanets, and focus our attentions on those with the best chances of other beings. Perhaps one of them may write a blog with us someday.

As always, be sure to leave a comment with any questions. You can also reach us on Facebook, Twitter, and Tumblr.

Remember to be curious, and stay mindful!

Written By: Cody Wolf 

Sources:

  1. https://en.wikipedia.org/wiki/Exoplanet
  2. https://en.wikipedia.org/wiki/List_of_potentially_habitable_exoplanets
  3. https://www.nature.com/articles/d41586-017-07844-y
  4. http://www.nature.com/news/exoplanet-hunters-rethink-search-for-alien-life-1.23023
  5. https://en.wikipedia.org/wiki/Z_Pulsed_Power_Facility

Featured Image: https://wallpapercave.com/cool-planet-backgrounds

Making Art With DNA

Since the 1980’s, scientists have been making shapes out of DNA. In recent years, technological advances have increased to the point where we can now make beautiful designs from the molecule that encodes our existence. It’s called DNA Origami.

The idea is relatively simple. A single strand of a DNA molecule is used as a scaffold. The scaffold is then molded to design the shape desired with “staple molecules” or short complementary sequences of DNA that will fold the scaffold strand.

2_1
An example of Scaffold and Staple DNA construction. Source

With the right computer programs, you can make a wide variety of shapes, including smiley faces, teddy bears, or even a box equipped with a lid and a lock.

Of course, it’s always fun when scientists get to play around, but there are some pretty impressive applications to this technique as well.

Scientists have been adapting DNA origami to form various objects (a sphere, or a box) able to carry drugs to a target site within the body. For example, chemotherapy and immunotherapy drugs for cancer patients wreak havoc on the body. However, if they are able to be transferred to the tumor itself, not only would you have reduced toxicity, you would also potentially increase your chance of destroying the tumor.

2016_SL_Origami_twosmileys
An example of various shapes that can be made with DNA origami. Source

Others have also worked to create “nanobots” (extremely small functional robots) from DNA. These nanobots reportedly have the capability of being pre-programmed to travel to certain areas and perform basic functions. While the technology is very new and has not been tested in humans yet, it appears to be a promising avenue of research.

While DNA origami technology has come a long way, scientists have been limited on one aspect; size.

Currently, the largest a DNA origami shape could be is about 100 nanometers. If larger than that, the shapes loose their stability.

Yesterday however, four papers published in Nature describes methods of evading this problem.

origamiexamples
DNA Origami box. Source

By creating small DNA origami V-shaped structures and allowing them to link together, scientists have overcome the size restrains. These structures can then be used to make large, stable structures like the sphere below.

nature origami 1
A representation of the DNA V building blocks. Source

These larger spheres then possess the capability of carrying a wide variety of items, including drugs for various diseases.

 

Researchers also developed a new design software that can generate pictures and make DNA origami representations of pictures, like the Mona Lisa for example.

 

 

nature origami 2
Representations of the size of molecules able to be generated with new DNA origami techniques. Source

Another complicating aspect to DNA origami is price. Creating the proper strands to make these complex structures takes a lot of time, and a lot of resources. One way to overcome the price is to develop a long single stranded DNA molecule that possess not only the staple and scaffold strands, but also section able to break apart the other sections of the same molecule (called a DNAzyme). This one strand will therefore be able to cleave the scaffold and staple strands from itself and be able to make the structure, thus decreasing the cost.

 

The advancement of creating DNA structures has been fascinating to watch the last decade, and with these new advancements, DNA origami technology will quickly become a pioneer technique in a variety of scientific fields.

As always, if you have questions, please comment below or email us directly at copernicuscalledblog@gmail.com.

You can also reach us on our various social media outlets, including Facebook, Twitter, and Tumblr.

Sources:

  1. Service, Robert F., Scientists shape DNA into doughnuts, teddy bears, and an image of the Mona Lisa. Science. http://www.sciencemag.org/news/2017/12/scientists-shape-dna-doughnuts-teddy-bears-and-image-mona-lisa
  2. Zhang, Fei, Yan, Hao. DNA self-assembly scaled up. Nature. https://www.nature.com/articles/d41586-017-07690-y#ref-CR2
  3. https://www.nature.com/articles/d41586-017-07690-y#ref-CR2
  4. Wagenbauer, K. F. et al. Nature 552, 78–83 (2017)
  5. Tikhomirov, G. et al. Nature 552, 67–71 (2017).
  6. Featured image- https://www.yourgenome.org/activities/origami-dna

 

 

 

 

 

 

 

 

Teenage Nutrition Study Goes Wrong

In research, it is crucial to not only ensure that data collected is meaningful and sound, but also that subjects (whether it be animals or humans) are treated properly.

Recent stories have been released in regards to a nutrition study from researchers at Purdue University that highlight examples of what not to do in a scientific study.

The purpose of the study was to evaluate the effects of low sodium diets on adolescent children with high blood pressure. Children were signed up for a seven week trial over a summer that placed them in campus housing. The project was dubbed Camp DASH, an abbreviation for Dietary Approaches to Stop Hypertension(1,2).

Everything went awry after a video of one of the girl participants showering appeared on social media. The police were notified and other accusations arose involving additional children within the study.

It appears from the start, the study was inadequate in planning, and was not fully prepared for hosting the adolescent children.

Within the first week of the study, it was reported that two participants were arrested due to violence among the adolescent children. Injuries were severe enough warrant a hospital visit for one of the participants. Both of the children were removed from the study, but this highlights the first of many faults in this study; lack of proper supervision(1,2)

Just one week after the two were dismissed, another accusation arose involving one male participant sexually harassing several of the female participants. The male was ejected from the study, but the harassment was not reported to necessary university personnel.(1)

During an unsupervised sauna session, a male reportedly burned another male participant with a hot rock that left second degree burns(1,2)

These are just a few examples of the many incidences that occurred during the time of the study.

The principal investigator of Camp DASH, Dr. Connie Weaver, has been brought under scrutiny for the research, and from the reports, it appears to be just.

Dr. Weaver was notified throughout the entire study of the misconduct going on, and did not make the proper corrections to ensure the safety of the children within the study(1)

In a statement released earlier this week, Dr. Weaver commented on allegations arising from the study.

“I am deeply saddened by the instances that caused Camp DASH to end early. As the principal investigator, I accept responsibility for events that occurred at Camp DASH. The safety and security of research participants always comes first.” (3)

Not only were the accusations hidden, but personnel staff were not properly screened before beginning the study.

Every hired member of the camp  were required to undergo a detailed background check. Only seven of the 132 members were screened (2). Furthermore, each member on the staff was required to complete online training before the study began. Thirteen percent of staff members did not complete the training, including the Camp Manager, who did not complete his training until the day he was terminated.

As a result of the problems within the study, the university ended it two weeks prior to its scheduled completion date, and all of the data generated from the study was discarded.

This is a perfect example of research misconduct during human trials. Not only did the principal investigator overlook accusations, she did fulfill the duties of keeping the subjects safe that were specifically written during her proposal.

This neglect thus resulted in directly wasting 8.8 million dollars from the NIH (federal funding source), and placing over 70 adolescent children in an environment leading to violence and sexual harassment(2).

While the principal investigator and university staff overseeing Camp DASH have not been directly reprimanded, we expect more news to be released as the story develops.

Be sure to look for our updates as news continues.

 

We recommend that if you are interested, to read this detailed report written by Alysa Rollock, the Vice President for Ethics and Compliance at Purdue University.

As always, if you have any questions or comments, feel free to comment below or email us directly at copernicuscalledlblog@gmail.com

 

You can also reach us on Facebook, Twitter, and Tumblr.

 

Written By: Cody Wolf

Sources

  1. Rollock, Alysa. “Report on Review and Assessment of Purdue University’s Actions in Connection with the Camp DASH Research Study. Accessed online 12/1/2017. https://www.purdue.edu/newsroom/documents/campdash-report.pdf

 

  1. Gastelum, Amy. “Purdue University Mounted a Child Nutrition Study. It Went Very, Very Wrong.” Undark.org. https://undark.org/article/purdue-camp-dash-nutrition-weaver/

 

  1. Menchaca, Mateo. “Purdue review board throws out Camp DASH data.” The Exponent. https://www.purdueexponent.org/campus/article_5ec9584b-1565-502d-a6f5-f49498411138.html

Adding Letters to our Genetic Alphabet

Many of us are aware of DNA, the molecule often nicknamed our “genomic book”. Ever since the structure of DNA has been revealed, scientists have been working 24/7 to understand how it works, and how we can manipulate it.

With today’s technology, more than 60 years after revealing the structure and composition of DNA, we can mutate, add on, or take off sections of our genome and utilize it to our benefit.

Now after years of research, scientists from California have been able to take it one step further by adding letters to the book.

Before we dive into our news item, let’s take a few minutes for some background. If you have knowledge about DNA and how it encodes protein, you can skip this section:

Imagine if you will, the english alphabet (A-Z). Twenty-six letters mixed together can create millions of words. These words then come together to create stories…or blog posts.

Our genomic alphabet is comparatively small. In fact, it only has four letters; A, T, C, and G. Each “letter” is a symbol for molecules. A is Adenine, T is Thymine, C is Cytosine, and G is Guanine (note: RNA replaces thymine with uracil (U), we will not discuss this today). These molecules are commonly called bases.

DNAbases
The Four Bases of DNA (A,T,C,G) 1

These molecules pair up together to make the double stranded DNA helix we all know and love today. The two strands are bound together by bonds between these four bases. A will bind with T, and G will bind with C

These molecules make up your genes. Each gene is a long strand of the four bases, and thus affect the functionality of your gene.

Some of you may be asking, how exactly a gene works. Well, here is a quick introduction.

Take for example a sample gene we have created below

ATTGTTCGGGATTCTTCGAAATGG

This gene is one DNA strand that will eventually turn into a protein. It is proteins that then travel throughout the cell and perform various functions that we think of as genes (eye color, hair color, etc..)

In order for DNA to create a protein, it must first be converted into RNA. RNA is very similar to DNA, with only slight differences between the two. RNA is single stranded rather than double stranded, and rather than having thymine as one of the “letters” it has uracil (U). Thus in RNA, A will bind to U. RNA is made from the template DNA strand and is complementary.

DNA20vs20RNA
Comparing DNA and RNA 2

So taking our example,

ATTGTTCGGGATTCTTCGAAATGG

The complementary RNA strand would look like this,

UAACAAGCCCUAAGAAGCUUUACC

Once the RNA strand has been synthesized, it will be used as template to make proteins. In order to make proteins, RNA is read by another molecule (called the ribosome) that will make “words” out of the letters of RNA.

Our example RNA molecule will be read three letters at a time (commonly called codons)

UAA CAA GCC CUA AGA AGC UUU ACC

These codons then are used as a guide to make protein. Every protein is made up of 20 components called amino acids. The 3 letter words above will thus code for an amino acid to make protein (note; there have been a few other amino acids discovered, but are extremely rare and will not be discussed today). These 20 amino acids will then fold together to make complex and specific protein structures. 

protein_-_primary_structure
An example of a small chain of amino acids 3

UAA CAA GCC CUA AGA AGC UUU ACC

UAA= Phenylalanine

CAA= Glutamine

GCC= Alanine

CUA= Leucine

AGA= Arginine

AGC= Serine

UUU= Phenylalanine

ACC= Threonine

Looking at the example above, we see that there are 2 codons that encode for the same amino acid. This is due to the amount of possible codons and amino acids. As mentioned, there are 20 different amino acids. With the four letters of DNA and RNA, there are 64 possible codons. Thus, multiple codons can correlate to the same amino acid in the code.

Now to our news item!

Scientists have recently been able to add two more letters into the genetic code.

Why would it be beneficial to add letters to the genetic alphabet? Going back to our book analogy, imagine if the english alphabet received an additional two letters. These letters can in turn add thousands and thousands of word to our language. These words in turn can be used in stories you read….or blog posts.

In the genetic book, adding new bases allows us to incorporate synthetic amino acids (not found in nature). Now rather than being stuck with 64 different codons, with two more bases, we now have 216 (over 3 times the amount) of codons to work with, each being able to potentially incorporate new amino acids.

This will allow us to change the structure of proteins and how they function, and thus change gene expression.

The research done by these scientists included modifying a famous protein, dubbed green fluorescent protein (GFP for short), a protein that glows a bright green color.

green-fluorescent-protein-molecule-laguna-design
A 3-D representation of GFP 4

While the alterations made to the gene did not directly affect the function of the protein, this is just the beginning of altering our code in a new way to fight diseases and unlock more clues about the evolution of life.

It is very exciting to be at the forefront of this research. We are sure that in the upcoming months more will be revealed and utilized with this technique.The Copernicus Called crew is excited to read and share more as the research is expanded.

As always, if you have questions or comments, do not hesitate to comment on this blog or email us directly at copernicuscalledblog@gmail.com.

Be sure to follow us on Facebook, Twittter, and Tumblr to keep up with the crew and receive updates when new blogs are published.

As always, remember to be curious and stay mindful!

Written By: Cody Wolf

Sources: 

The background information was supplied from my knowledge during my undergraduate and graduate career. If you have any questions, you can contact me via our email. I would also recommend visiting this page to see descriptive videos on how DNA makes protein. 

  1. Cover Picture Source- http://blogs.timesofisrael.com/ethical-legal-and-social-concerns-with-genetically-modified-human-embryos/
  2. Callaway, Ewen. ‘”Alien’ DNA makes proteins in living cells for the first time.” Nature News. Online. https://www.nature.com/news/alien-dna-makes-proteins-in-living-cells-for-the-first-time-1.23040?WT.ec_id=NEWSDAILY-20171130&utm_source=briefing&utm_medium=email&utm_campaign=20171130
  3. Zhang, Y. et al. Nature http://dx.doi.org/10.1038/nature24659 (2017).