Adding Letters to our Genetic Alphabet

Many of us are aware of DNA, the molecule often nicknamed our “genomic book”. Ever since the structure of DNA has been revealed, scientists have been working 24/7 to understand how it works, and how we can manipulate it.

With today’s technology, more than 60 years after revealing the structure and composition of DNA, we can mutate, add on, or take off sections of our genome and utilize it to our benefit.

Now after years of research, scientists from California have been able to take it one step further by adding letters to the book.

Before we dive into our news item, let’s take a few minutes for some background. If you have knowledge about DNA and how it encodes protein, you can skip this section:

Imagine if you will, the english alphabet (A-Z). Twenty-six letters mixed together can create millions of words. These words then come together to create stories…or blog posts.

Our genomic alphabet is comparatively small. In fact, it only has four letters; A, T, C, and G. Each “letter” is a symbol for molecules. A is Adenine, T is Thymine, C is Cytosine, and G is Guanine (note: RNA replaces thymine with uracil (U), we will not discuss this today). These molecules are commonly called bases.

DNAbases
The Four Bases of DNA (A,T,C,G) 1

These molecules pair up together to make the double stranded DNA helix we all know and love today. The two strands are bound together by bonds between these four bases. A will bind with T, and G will bind with C

These molecules make up your genes. Each gene is a long strand of the four bases, and thus affect the functionality of your gene.

Some of you may be asking, how exactly a gene works. Well, here is a quick introduction.

Take for example a sample gene we have created below

ATTGTTCGGGATTCTTCGAAATGG

This gene is one DNA strand that will eventually turn into a protein. It is proteins that then travel throughout the cell and perform various functions that we think of as genes (eye color, hair color, etc..)

In order for DNA to create a protein, it must first be converted into RNA. RNA is very similar to DNA, with only slight differences between the two. RNA is single stranded rather than double stranded, and rather than having thymine as one of the “letters” it has uracil (U). Thus in RNA, A will bind to U. RNA is made from the template DNA strand and is complementary.

DNA20vs20RNA
Comparing DNA and RNA 2

So taking our example,

ATTGTTCGGGATTCTTCGAAATGG

The complementary RNA strand would look like this,

UAACAAGCCCUAAGAAGCUUUACC

Once the RNA strand has been synthesized, it will be used as template to make proteins. In order to make proteins, RNA is read by another molecule (called the ribosome) that will make “words” out of the letters of RNA.

Our example RNA molecule will be read three letters at a time (commonly called codons)

UAA CAA GCC CUA AGA AGC UUU ACC

These codons then are used as a guide to make protein. Every protein is made up of 20 components called amino acids. The 3 letter words above will thus code for an amino acid to make protein (note; there have been a few other amino acids discovered, but are extremely rare and will not be discussed today). These 20 amino acids will then fold together to make complex and specific protein structures. 

protein_-_primary_structure
An example of a small chain of amino acids 3

UAA CAA GCC CUA AGA AGC UUU ACC

UAA= Phenylalanine

CAA= Glutamine

GCC= Alanine

CUA= Leucine

AGA= Arginine

AGC= Serine

UUU= Phenylalanine

ACC= Threonine

Looking at the example above, we see that there are 2 codons that encode for the same amino acid. This is due to the amount of possible codons and amino acids. As mentioned, there are 20 different amino acids. With the four letters of DNA and RNA, there are 64 possible codons. Thus, multiple codons can correlate to the same amino acid in the code.

Now to our news item!

Scientists have recently been able to add two more letters into the genetic code.

Why would it be beneficial to add letters to the genetic alphabet? Going back to our book analogy, imagine if the english alphabet received an additional two letters. These letters can in turn add thousands and thousands of word to our language. These words in turn can be used in stories you read….or blog posts.

In the genetic book, adding new bases allows us to incorporate synthetic amino acids (not found in nature). Now rather than being stuck with 64 different codons, with two more bases, we now have 216 (over 3 times the amount) of codons to work with, each being able to potentially incorporate new amino acids.

This will allow us to change the structure of proteins and how they function, and thus change gene expression.

The research done by these scientists included modifying a famous protein, dubbed green fluorescent protein (GFP for short), a protein that glows a bright green color.

green-fluorescent-protein-molecule-laguna-design
A 3-D representation of GFP 4

While the alterations made to the gene did not directly affect the function of the protein, this is just the beginning of altering our code in a new way to fight diseases and unlock more clues about the evolution of life.

It is very exciting to be at the forefront of this research. We are sure that in the upcoming months more will be revealed and utilized with this technique.The Copernicus Called crew is excited to read and share more as the research is expanded.

As always, if you have questions or comments, do not hesitate to comment on this blog or email us directly at copernicuscalledblog@gmail.com.

Be sure to follow us on Facebook, Twittter, and Tumblr to keep up with the crew and receive updates when new blogs are published.

As always, remember to be curious and stay mindful!

Written By: Cody Wolf

Sources: 

The background information was supplied from my knowledge during my undergraduate and graduate career. If you have any questions, you can contact me via our email. I would also recommend visiting this page to see descriptive videos on how DNA makes protein. 

  1. Cover Picture Source- http://blogs.timesofisrael.com/ethical-legal-and-social-concerns-with-genetically-modified-human-embryos/
  2. Callaway, Ewen. ‘”Alien’ DNA makes proteins in living cells for the first time.” Nature News. Online. https://www.nature.com/news/alien-dna-makes-proteins-in-living-cells-for-the-first-time-1.23040?WT.ec_id=NEWSDAILY-20171130&utm_source=briefing&utm_medium=email&utm_campaign=20171130
  3. Zhang, Y. et al. Nature http://dx.doi.org/10.1038/nature24659 (2017).

 

Advertisements

To Treat or Not to Treat; That is the Question – At Least for Prostate Cancer

Cody Wolf

I’m sure that many of our readers know (or at least you will in a few moments) that I am a cancer researcher. It of course makes sense then that one of my first blog posts is on cancer. I also happen to study prostate cancer. This article came across my desk recently and I could not help but share it with the Copernicus Called Family.

So….Here Goes.

cancer-cell
Source

Cancer is by far one of the largest threats that currently looming over societies head.Prostate cancer is especially worrisome, being the third leading cause of cancer deaths in the United States for males; behind lung and colorectal (colon) cancer [1]

That being said, being diagnosed with prostate cancer does not necessarily indicate a painful or tragic death. In fact, a recent article in The New England Journal of Medicine sought out to study exactly when treatments are necessary for prostate cancer patients……and when watching without conventional treatment may be the best option.

Although prostate cancer still is high on the list for mortality in men, many patients are diagnosed at a very early stage. Currently Stage 1 and stage 2 prostate cancer (tumor contained within the prostate, no lymph node metastasis, no metastasis to other organs) has a 5 year survival rate of 99%. That’s pretty great. And  later stages of prostate cancer have a high survival rate (nearly 100%) even though the cancer has potentially spread to nearby areas (regional lymph nodes)

So, I mean, this is all pretty good news right? The only downside is of course cancer that has spread to distant areas of the body (brain, liver, bones), which has a survival rate of 29%. Not the best. [2]

But, fortunately many men who are diagnosed usually fall into the Stage 1 to Stage 2 category. About 4 out of 5 cases actually. [2]

Therefore, medical doctors are faced with the question on how to treat early stage prostate cancer.

Back in the good ole’ days, prostate cancer was considered a major issue, even at Stage 1.

Men would get checked, blood and pee would be analyzed, and then prostates would be cut. Pretty routine procedure that did indeed prevent cancer. The official term is radical prostatectomy (removing the whole prostate and neighboring tissues). There are various methods for surgery. If you would like to read more about the subject, please follow this link.

But…there’s a small problem. Side effects from a radical prostatectomy aren’t the best. These include incontinence (leaking of urine from the urethra) and incompetence (do I need to explain this one?). For a man potentially in his 40’s, the downsides of surgery are just a little bit daunting.

best-doctors-established-by-doctors-used-all-around-the-world_image715_292
Source

 

So what can physicians do?

The best way to determine whether or not surgery should be performed regardless of the consequences, is to study whether or not it has a major effect on survival for patients.

Turns out… for the early stages of prostate cancer, we may want to hold the scalpel.

The study previously mentioned supports the hypothesis that a radical prostatectomy is just a bit overkill.

At this time it’s important to note that this study is not the only one to propose this idea. In fact, the authors of this current study published something similar four years ago.

And there have been a few other sources that favor this hypothesis.

Let’s get into this study.

731 lucky patients with localized prostate cancer were divided into 2 groups. One group received radical prostatectomy surgery, and the other received nothing but observation (medical doctors call this active surveillance or watchful waiting).

Now you may be wondering how long the study lasted. 5 years? 10 years? Well in reality, it was more like 15-16 years. Patients were randomly assigned from 1994-2002 (do not confuse this with the length of the study, this is how long they were selecting patients), and then all patients were observed until August of 2014. Quite a long time.

The Data

calculator
Source

Well, after the study, 64% of the men had died. This may sound devastating, but we must remember that the majority of males diagnosed with prostate cancer are older, and this study has the average age at 67 years. Not spring chickens.

The researchers address this by determining the “all cause mortality” or in layman’s terms, dying from anything. What they found is that there was no significant difference in those who received treatment, and those who did not. Note: Statistical significance is extremely important in research, and this will be discussed more thoroughly in another blog.

Another powerful piece of data is the comparison of those who died due to prostate cancer rather than non-related deaths. Death by cancer occurred in 69 men, or 9.4% of those in the study. 65 deaths were attributed to prostate cancer and 4 to treatment complications.

Death due to prostate cancer occurred in 7.4% of those in the surgery group, and 11.4% in the observation group. Again the differences between the two groups are not significantly different.

Another aspect of this study that is interesting, is what the patients thought of different treatment conditions. Subjects were asked to fill out a Medical Outcomes Study 12-Item Short-Form General Health Survey (from what I can gather it’s just a fancy name for a survey to asks how patients feel about their treatment).

Overall, worry about health did not differ between groups. But, the interesting fact is that men who received surgery reported more complications due to prostate cancer or treatment, physical discomfort, and limitations to daily activities. Incontinence also was an issue with those who underwent surgery, and erectile dysfunction occurred in a significant portion of those who visited the surgeon’s table.

There is a touch more to the study, but we will not cover those in the blog today. If you are interested, and want learn more, follow the link to the study.

Now, so far I have talked about this study as if it’s the finality of the topic, but really it’s not.

One of the main issues I have with this study is the statistical significance. As mentioned above, we will discuss this in much more detail at a later time, but I can’t help but get this off of my chest now.

Officially, a set of data is considered significant if the p value is at or below 0.05. In our context, this number would suggest that the probability that those treated with surgery and those not will have different outcomes (i.e beneficial to have surgery). This suggests that there is a 5% chance that the surgery is actually beneficial to patients.

If the p value is higher than 0.05, let’s just take a hypothetical number, 0.45. This hypothetical value suggests that 45% chance that the surgery is beneficial to patients.  So at that point, is it worth having the surgery, if it means that your sexual function is eliminated, or if you are forced to wear a pad due to a leaky urethra?

The p values for the study are just barely over the line of significance. For the overall mortality rates, and the prostate related deaths examined in this study, the p values were 0.06. So 6% of patients who receive treatment will have no difference in outcome based off their treatments.

Technically… by standards set, 0.06 is not a statistical significance. But it’s pretty damn close.

Let me be as clear as I can. I am not trying to change the way science works, or how statisticians evaluate data, and I am not trying to knock what the study suggests here.

But I do want our readers to be thinking. “Is this study really the final word?” I will let you, as the reader make the final decision.

doctor-old man
Source

That being said, I do not oppose the active surveillance treatment method. I think it’s a perfectly valid method for prostate cancer patients who are in the early stages. As more studies are performed, researchers and clinicians will be able to make the best decisions for their patients.

Thank you all for reading! I have just a few notes to add to today’s blog:

 

If you happen to be reading this, and you have prostate cancer or have recently been diagnosed, please do not take this blog post as medical advice. I will always recommend that you speak to your medical team and discuss the best options for your specific case. If you are seeking answers to questions, I would ask that you visit cancer.org. This website run by the American Cancer Society has fantastic information on all types of cancers (and was a great source for me writing this blog) and can direct you to assistance you may need.

 

And finally, since I am already on my soap box, I would like to remind everyone who is at the age for testing (whether it be prostate, breast, colorectal, or any other type) of various cancers. Please go. It is worth it. A small amount of discomfort now can prevent a lifetime of suffering. Testing is the best way to detect cancer early. 

 

As always, questions can be submitted to our email account copernicuscalledblog@gmail.com, on Facebook (CopernicusCalled), or Twitter (@CopernicusCalled).

 

Remember to always be curious, and stay mindful! 

Works Cited

  1. “Key Statistics for Prostate Cancer.” American Cancer Society. January, 5th, 2017 https://www.cancer.org/cancer/prostate-cancer/about/key-statistics.html
  2. “Survival Rates for Prostate Cancer.” American Cancer Society. May 30th, 2017. https://www.cancer.org/cancer/prostate-cancer/detection-diagnosis-staging/survival-rates.html
  3. “Watchful Waiting or Active Surveillance for Prostate Cancer.” American Cancer Society. March 11th, 2016. https://www.cancer.org/cancer/prostate-cancer/treating/watchful-waiting.html
  4. “Surgery for Prostate Cancer.” American Cancer Society. March 11th, 2016. https://www.cancer.org/cancer/prostate-cancer/treating/surgery.html
  5. Wilt TJ, Jones KM, Barry MJ, Andriole GL, Culkin D, Wheeler T, Aronson WJ, Brawer MK. “Follow-up of Prostatectomy versus Observation for Early Prostate Cancer.” New England Journal of Medicine. 377:132-142. July 13 2017. DOI:10.1056/NEJMoa1615869. http://www.nejm.org/doi/full/10.1056/NEJMoa1615869
  6. Featured image credit-http://www.globalpatientservice.com/prosatate-cancer.php

New Research Suggests T-Rex is Unable to Hug AND Run

Cody Wolf

Most everyone has probably seen at least one installment of the Jurassic Park series. For those of you in the small population, the main plot of each movie is running away from a ferocious predator, usually a Tyrannosaurus Rex or some similar carnivorous dinosaur. The protagonist typically has the job of running, driving, or otherwise hiding to avoid being eaten alive.

Much like in the movies, the world of dinosaurs, at least in the research of dinosaurs, has thought that a T-Rex had the capability to run and catch fast prey.

Certain research articles suggest that dinosaurs like a T-Rex could run upwards to 50-60 kilometers per hour, or about 37 miles per hour(Paul, 1998). That’s pretty damn fast.

However, a recent study published in Peer J suggests that a T-Rex was actually incapable of running. In this particular study, running was defined as a gait that would be running without having both feet off of the ground at the same time, for example a horse gallop.

So with Velociraptors being the actual size of our modern turkey, and a T-Rex being unable to run, Jurassic Park may not be such a bad idea after all….Just kidding.  

But how in the world can a T-Rex be incapable of running?

The study that previously mentioned a high speed for the T-Rex suggested so due to their long and strong legs and specialized hip structure. This new study indicates that the legs of a T-Rex was actually the reason why they couldn’t run. In fact, their top speed reached about 12 mph.

How can two studies contradict each other when they are looking at the exact same information?

The answer of course, is in the details.

 

If you get a chance to read the Peer J article (which I always recommend), the introduction focuses on previous studies and the various mechanisms used to determine speed. While we don’t have enough time to go over all of them, I figured one may be beneficial to our readers.

Blog #2 T-Rex Can't Run

Gregory S. Paul published an article in 1998 suggesting that a T-Rex, with its specialized pelvis and leg structures being similar to modern tetrapods (four legged creatures), would be able to run at a reasonable pace. In case you are unfamiliar with the running patterns of different species (which I was until researching for this article), it’s important to note that a Rhinoceros, having a similar pelvic and leg structure is able to run at a reasonable pace. They are also quite large. Meanwhile, an elephant, which is more comparable in weight to a large T-Rex has a very different bone structure and is designed specifically for walking (see figure above). Elephants also have an ankle that prevents mobility (which differs from ours, a Rhino’s, and a T-Rex) and have a “flat” pelvis more similar to humans. In addition, examining the shape and orientation of the hip bones of Tyrannosaurus suggests that it is better suited to maintain the weight of its owner and can give it the ability of running.

Paul continues to discuss the correlations of femur bone length and speed where there appears to be a positive correlation between speed and the length of your thigh bone. He also goes on to discuss how bone shapes and certain structures can suggest how fast an animal is able to run.

He then focuses on other studies that suggest a T-Rex is unable to run. One in particular highlights the frailty of the leg bone, and how running could not be possible with the average weight of these gigantic creatures. Paul points out that the femur of a T-Rex may be able to support more weight than expected with these models, largely due to the thicker walls of the femur. He also mentioned discrepancies with the weight they predicted and the fossils analyzed have damage that would confound the data.

As I am sure you have noticed by now, there appears to be a slight conflict in regard to the speed of our beloved dinosaur.

So what does this new study have to say?

The Paul study we just previously mentioned, and other studies that conflict with it all have one thing in common. The research is focused only on bone morphology. All of these scientists spent time studying fossil structures and comparing them to bones of modern animals to “tweak out” clues of what life being a T-Rex was like.

But there is one aspect missing; the tissue.

Blog #2 T-Rex cant run pic 2

 

Bone alone cannot work to move our limbs. Soft tissues like muscles are needed to let our bodies twist and turn. And these soft tissues can have an impact of how we can move.

Recent advances in technology have given scientists the opportunity to estimate how muscles connected to bone, and how they affected movement in extinct species. This technique is what the Peer J article primarily utilizes.

The figure above shows an estimation of various muscle structures and limb interactions might have been like for the T-Rex. By scanning the bones and calculating joint positions and range of motion, muscle structure could then be predicted.

After this, computer models can be simulated. The output from the computer simulations were able to give a maximum velocity. The answer? Eh, about 8 meters per second. The data also calculated the estimated stride of the dinosaur (at its peak about 8 meters), and the Froude number (used to compare speeds with other animals) that suggested a T-Rex can only reach a walking stride.

Additional data that focuses on the change in kinetic and gravitational potential energy also confirms that a T-Rex could not gain the energy differences to achieve a running speed.

 

My Opinion

While I think this study makes valid points, and uses technology that can estimate at a much higher efficiency than previous analyses, there is still much to weed out. Unfortunately, soft tissue does not preserve well and we most likely will not find a perfectly preserved T-Rex. However as technology increases in power, and as we work to understand how other tissues might have impacted the movement of the large dinosaurs, much more is left to be discovered. I do think this study is moving in the right direction, and gives us more information than we had previously. If you are interested in either of the articles I discussed today, the links are below. Attached here is also a link to videos the scientists produced with their program of the simulated T-Rex walking!

If you have any questions, or comments about this article or others, please do not hesitate to email us directly at copernicuscalledblog@gmail.com. You can also reach us through social media, at our Facebook and Twitter pages.

 

Remember to always be curious, and stay mindful!

 

Sources:

1.May, Ashely. Sorry, ‘Jurassic Park’ fans: The T. rex couldn’t run, new research says. USA Today, July 19, 2017. https://www.usatoday.com/story/news/nation-now/2017/07/19/t-rex-couldnt-run-new-research-says/491122001/

2. Paul, Gregory. Limb Design, Function, and Running performance in Ostrich-Mimics and Tyrannosaurs. Gaia 15. December, 1998. http://gspauldino.com/GaiaLimbdesign.pdf

3. Sellers, William. Investigating the running abilities of Tyrannosaurus rex using stress-constrained multibody dynamic analysis. Peer J. July 18,2017. https://peerj.com/articles/3420/.

4. Title picture source- https://www.pinterest.com/pin/474003929501926665/

 

 

Cannibal Caterpillars

 Cody Wolf

Plants, like many other life forms, have to adapt in order to combat the many predators that threaten their existence. Several varieties of plants have developed various techniques to prevent becoming insect feces. A brief communication published in Nature Ecology & Evolution highlights a….. unique way plants evolve to fight their little enemies.

Although most people are fascinated by plants, many are unaware of just how amazing they really are. Many plants are able to halt insects and other potential predators by developing weapons to prevent or delay consumption.

There are several types of mechanisms plants have developed, but here are a two quick examples:

Mechanical defenses– Plants utilize this mechanism by producing thorns, needles, or perhaps other other specialized structures such as waxy resins to make feeding difficult. I am sure most of you are thinking of plants like a cactus, or perhaps a thorny rose bush. Mechanical defenses are the most common type of herbivore defenses among plants

Chemical Defenses– Another technique for defense is chemical warfare. Literally. Many plants have developed complicated chemicals with complicated names (such as terpenoids, phenolics, and nitrogen compounds like alkaloids, benzoxazinoids, and many others) that specialize in destroying/inhibiting potential threats.

These molecules work to either deter the insect from eating (like inhibiting enzymes important for digestion, making consumption extremely difficult) or can possibly destroy DNA repair mechanisms in these little buggers and render them completely helpless (aka death from weird insect cancer).

Obviously, some of these chemicals are dangerous to ingest, but there are quite a few that have inserted themselves into our everyday culture, and are relatively harmless. Caffeine, morphine, cocaine (okay, cocaine isn’t exactly harmless), and nicotine all fall into this category.

Biologists call these defense mechanisms Host-Plant-Resistance or HRP for short.

Note: There are other mechanisms of defense considered in the HRP category that we will not be discussing today.

So..let’s get back to the current article. Recently scientists at the University of Wisconsin in Madison have discovered a completely novel HRP in Solanum lycopersicum or better known as the tomato plant.

In short, when the plant was exposed to a chemical secreted normally by plants in distress (yes, they can indeed “warn each other” so to speak), and then exposed to an arch nemesis, the small mottled willow moth, they found that plants who were exposed to the warning chemical had overall more biomass compared to the control plants or those who were not “cued” as well.

Plant biomass is a fancy way biologists explain how badly plants were eaten. The research team measured biomass by clipping the visible part of the plant (aka without the roots) and weighed the shrubs to compare biomass. Plants who received the highest dose of the “warning” chemical had as much as 5x the biomass compared to the non treated plants.

Interesting……

This data suggests that those plants who get warned properly have a mechanism to ward of those evil moths. So what exactly did the plants do?`

In case you happened to miss the title, the team in Wisconsin determined that cannibalism was at play.

Further experimentation is used to highlight the relationship between plant and insect.  

Tomato plants were once again warned with the various concentrations of the chemical (or not at all), but this time they removed the leaves and fed them to the caterpillars. The team noticed that those insects fed with warned plants tended to eat dead larvae planted inside their containers sooner than the control plants.

It is important to mention at this point, that herbivores such as the lovely small mottled willow moth, will eventually eat their friends if food becomes scarce. It really is a moth-eat-moth world. But for the first time, scientists are actually seeing that plants have the possibility to trick the caterpillars into eating themselves even when they have an abundance of food.

Now, many of you may be wondering; “Why don’t all plants have a defense mechanism such as this?”

The short answer is that it’s not as easy as it seems.

Although plants may benefit from this chemical defense system, HRP mechanisms are extremely costly for vegetation. It takes a ton of energy for plants to make molecules strong enough to make fellow caterpillars look delicious. There are many plants on our planet that lack defense mechanisms. They may be potentially more exposed, but they are able to allocate energy to other important mechanisms (photosynthesis, water uptake, etc..)

As of right now specifics on the properties of these cannibal inducing molecules, and how they actually work towards influencing caterpillars to eat dead comrades is vague, at least from the news article published on Nature.com. It’s also worth mentioning that brief communications piece is not a full-fledged article. The information has not been peer reviewed and there is much left to do to piece out the details of how these species co-exist.

To wrap up: The article mentioned highlights a novel defense mechanism for plants that has previously been undiscovered by biologists. While this article is not the final word on the issue, it does create an interesting starting point for scientists to weed out specifics and potentially (a long time from now) morph this information and create potential pesticide treatments.

But let’s not get ahead of ourselves.

THANKS for reading our humble blog! Please feel free to email the crew at copernicuscalledblog@gmaill.com if you have any questions about this article, previous articles, or anything you may have heard in your own travels.

You can also follow us on Twitter(@CopernicusCalls) , and Facebook.

 

Remember to always be curious, and stay mindful!

 

Sources:

1. Castells,Laura. “Plants turn caterpillars into cannibals.” Nature News. 10, July, 2017. http://www.nature.com/news/plants-turn-caterpillars-into-cannibals-1.22281?WT.ec_id=NEWSDAILY-20170710
2. Orrock,Connelly, and Kitchen. “Induced defences in plants reduce herbivory by increasing cannibalism.”  Nature Ecology & Evolution 1, 1205–1207 (2017) .10,July, 2017.  doi:10.1038/s41559-017-0231-6.https://www.nature.com/articles/s41559-017-0231-6

3. Picture source- http://globe-views.com/dreams/caterpillar.html