Making Art With DNA

Since the 1980’s, scientists have been making shapes out of DNA. In recent years, technological advances have increased to the point where we can now make beautiful designs from the molecule that encodes our existence. It’s called DNA Origami.

The idea is relatively simple. A single strand of a DNA molecule is used as a scaffold. The scaffold is then molded to design the shape desired with “staple molecules” or short complementary sequences of DNA that will fold the scaffold strand.

2_1
An example of Scaffold and Staple DNA construction. Source

With the right computer programs, you can make a wide variety of shapes, including smiley faces, teddy bears, or even a box equipped with a lid and a lock.

Of course, it’s always fun when scientists get to play around, but there are some pretty impressive applications to this technique as well.

Scientists have been adapting DNA origami to form various objects (a sphere, or a box) able to carry drugs to a target site within the body. For example, chemotherapy and immunotherapy drugs for cancer patients wreak havoc on the body. However, if they are able to be transferred to the tumor itself, not only would you have reduced toxicity, you would also potentially increase your chance of destroying the tumor.

2016_SL_Origami_twosmileys
An example of various shapes that can be made with DNA origami. Source

Others have also worked to create “nanobots” (extremely small functional robots) from DNA. These nanobots reportedly have the capability of being pre-programmed to travel to certain areas and perform basic functions. While the technology is very new and has not been tested in humans yet, it appears to be a promising avenue of research.

While DNA origami technology has come a long way, scientists have been limited on one aspect; size.

Currently, the largest a DNA origami shape could be is about 100 nanometers. If larger than that, the shapes loose their stability.

Yesterday however, four papers published in Nature describes methods of evading this problem.

origamiexamples
DNA Origami box. Source

By creating small DNA origami V-shaped structures and allowing them to link together, scientists have overcome the size restrains. These structures can then be used to make large, stable structures like the sphere below.

nature origami 1
A representation of the DNA V building blocks. Source

These larger spheres then possess the capability of carrying a wide variety of items, including drugs for various diseases.

 

Researchers also developed a new design software that can generate pictures and make DNA origami representations of pictures, like the Mona Lisa for example.

 

 

nature origami 2
Representations of the size of molecules able to be generated with new DNA origami techniques. Source

Another complicating aspect to DNA origami is price. Creating the proper strands to make these complex structures takes a lot of time, and a lot of resources. One way to overcome the price is to develop a long single stranded DNA molecule that possess not only the staple and scaffold strands, but also section able to break apart the other sections of the same molecule (called a DNAzyme). This one strand will therefore be able to cleave the scaffold and staple strands from itself and be able to make the structure, thus decreasing the cost.

 

The advancement of creating DNA structures has been fascinating to watch the last decade, and with these new advancements, DNA origami technology will quickly become a pioneer technique in a variety of scientific fields.

As always, if you have questions, please comment below or email us directly at copernicuscalledblog@gmail.com.

You can also reach us on our various social media outlets, including Facebook, Twitter, and Tumblr.

Sources:

  1. Service, Robert F., Scientists shape DNA into doughnuts, teddy bears, and an image of the Mona Lisa. Science. http://www.sciencemag.org/news/2017/12/scientists-shape-dna-doughnuts-teddy-bears-and-image-mona-lisa
  2. Zhang, Fei, Yan, Hao. DNA self-assembly scaled up. Nature. https://www.nature.com/articles/d41586-017-07690-y#ref-CR2
  3. https://www.nature.com/articles/d41586-017-07690-y#ref-CR2
  4. Wagenbauer, K. F. et al. Nature 552, 78–83 (2017)
  5. Tikhomirov, G. et al. Nature 552, 67–71 (2017).
  6. Featured image- https://www.yourgenome.org/activities/origami-dna

 

 

 

 

 

 

 

 

Advertisements

Adding Letters to our Genetic Alphabet

Many of us are aware of DNA, the molecule often nicknamed our “genomic book”. Ever since the structure of DNA has been revealed, scientists have been working 24/7 to understand how it works, and how we can manipulate it.

With today’s technology, more than 60 years after revealing the structure and composition of DNA, we can mutate, add on, or take off sections of our genome and utilize it to our benefit.

Now after years of research, scientists from California have been able to take it one step further by adding letters to the book.

Before we dive into our news item, let’s take a few minutes for some background. If you have knowledge about DNA and how it encodes protein, you can skip this section:

Imagine if you will, the english alphabet (A-Z). Twenty-six letters mixed together can create millions of words. These words then come together to create stories…or blog posts.

Our genomic alphabet is comparatively small. In fact, it only has four letters; A, T, C, and G. Each “letter” is a symbol for molecules. A is Adenine, T is Thymine, C is Cytosine, and G is Guanine (note: RNA replaces thymine with uracil (U), we will not discuss this today). These molecules are commonly called bases.

DNAbases
The Four Bases of DNA (A,T,C,G) 1

These molecules pair up together to make the double stranded DNA helix we all know and love today. The two strands are bound together by bonds between these four bases. A will bind with T, and G will bind with C

These molecules make up your genes. Each gene is a long strand of the four bases, and thus affect the functionality of your gene.

Some of you may be asking, how exactly a gene works. Well, here is a quick introduction.

Take for example a sample gene we have created below

ATTGTTCGGGATTCTTCGAAATGG

This gene is one DNA strand that will eventually turn into a protein. It is proteins that then travel throughout the cell and perform various functions that we think of as genes (eye color, hair color, etc..)

In order for DNA to create a protein, it must first be converted into RNA. RNA is very similar to DNA, with only slight differences between the two. RNA is single stranded rather than double stranded, and rather than having thymine as one of the “letters” it has uracil (U). Thus in RNA, A will bind to U. RNA is made from the template DNA strand and is complementary.

DNA20vs20RNA
Comparing DNA and RNA 2

So taking our example,

ATTGTTCGGGATTCTTCGAAATGG

The complementary RNA strand would look like this,

UAACAAGCCCUAAGAAGCUUUACC

Once the RNA strand has been synthesized, it will be used as template to make proteins. In order to make proteins, RNA is read by another molecule (called the ribosome) that will make “words” out of the letters of RNA.

Our example RNA molecule will be read three letters at a time (commonly called codons)

UAA CAA GCC CUA AGA AGC UUU ACC

These codons then are used as a guide to make protein. Every protein is made up of 20 components called amino acids. The 3 letter words above will thus code for an amino acid to make protein (note; there have been a few other amino acids discovered, but are extremely rare and will not be discussed today). These 20 amino acids will then fold together to make complex and specific protein structures. 

protein_-_primary_structure
An example of a small chain of amino acids 3

UAA CAA GCC CUA AGA AGC UUU ACC

UAA= Phenylalanine

CAA= Glutamine

GCC= Alanine

CUA= Leucine

AGA= Arginine

AGC= Serine

UUU= Phenylalanine

ACC= Threonine

Looking at the example above, we see that there are 2 codons that encode for the same amino acid. This is due to the amount of possible codons and amino acids. As mentioned, there are 20 different amino acids. With the four letters of DNA and RNA, there are 64 possible codons. Thus, multiple codons can correlate to the same amino acid in the code.

Now to our news item!

Scientists have recently been able to add two more letters into the genetic code.

Why would it be beneficial to add letters to the genetic alphabet? Going back to our book analogy, imagine if the english alphabet received an additional two letters. These letters can in turn add thousands and thousands of word to our language. These words in turn can be used in stories you read….or blog posts.

In the genetic book, adding new bases allows us to incorporate synthetic amino acids (not found in nature). Now rather than being stuck with 64 different codons, with two more bases, we now have 216 (over 3 times the amount) of codons to work with, each being able to potentially incorporate new amino acids.

This will allow us to change the structure of proteins and how they function, and thus change gene expression.

The research done by these scientists included modifying a famous protein, dubbed green fluorescent protein (GFP for short), a protein that glows a bright green color.

green-fluorescent-protein-molecule-laguna-design
A 3-D representation of GFP 4

While the alterations made to the gene did not directly affect the function of the protein, this is just the beginning of altering our code in a new way to fight diseases and unlock more clues about the evolution of life.

It is very exciting to be at the forefront of this research. We are sure that in the upcoming months more will be revealed and utilized with this technique.The Copernicus Called crew is excited to read and share more as the research is expanded.

As always, if you have questions or comments, do not hesitate to comment on this blog or email us directly at copernicuscalledblog@gmail.com.

Be sure to follow us on Facebook, Twittter, and Tumblr to keep up with the crew and receive updates when new blogs are published.

As always, remember to be curious and stay mindful!

Written By: Cody Wolf

Sources: 

The background information was supplied from my knowledge during my undergraduate and graduate career. If you have any questions, you can contact me via our email. I would also recommend visiting this page to see descriptive videos on how DNA makes protein. 

  1. Cover Picture Source- http://blogs.timesofisrael.com/ethical-legal-and-social-concerns-with-genetically-modified-human-embryos/
  2. Callaway, Ewen. ‘”Alien’ DNA makes proteins in living cells for the first time.” Nature News. Online. https://www.nature.com/news/alien-dna-makes-proteins-in-living-cells-for-the-first-time-1.23040?WT.ec_id=NEWSDAILY-20171130&utm_source=briefing&utm_medium=email&utm_campaign=20171130
  3. Zhang, Y. et al. Nature http://dx.doi.org/10.1038/nature24659 (2017).