Adding Letters to our Genetic Alphabet

Many of us are aware of DNA, the molecule often nicknamed our “genomic book”. Ever since the structure of DNA has been revealed, scientists have been working 24/7 to understand how it works, and how we can manipulate it.

With today’s technology, more than 60 years after revealing the structure and composition of DNA, we can mutate, add on, or take off sections of our genome and utilize it to our benefit.

Now after years of research, scientists from California have been able to take it one step further by adding letters to the book.

Before we dive into our news item, let’s take a few minutes for some background. If you have knowledge about DNA and how it encodes protein, you can skip this section:

Imagine if you will, the english alphabet (A-Z). Twenty-six letters mixed together can create millions of words. These words then come together to create stories…or blog posts.

Our genomic alphabet is comparatively small. In fact, it only has four letters; A, T, C, and G. Each “letter” is a symbol for molecules. A is Adenine, T is Thymine, C is Cytosine, and G is Guanine (note: RNA replaces thymine with uracil (U), we will not discuss this today). These molecules are commonly called bases.

DNAbases
The Four Bases of DNA (A,T,C,G) 1

These molecules pair up together to make the double stranded DNA helix we all know and love today. The two strands are bound together by bonds between these four bases. A will bind with T, and G will bind with C

These molecules make up your genes. Each gene is a long strand of the four bases, and thus affect the functionality of your gene.

Some of you may be asking, how exactly a gene works. Well, here is a quick introduction.

Take for example a sample gene we have created below

ATTGTTCGGGATTCTTCGAAATGG

This gene is one DNA strand that will eventually turn into a protein. It is proteins that then travel throughout the cell and perform various functions that we think of as genes (eye color, hair color, etc..)

In order for DNA to create a protein, it must first be converted into RNA. RNA is very similar to DNA, with only slight differences between the two. RNA is single stranded rather than double stranded, and rather than having thymine as one of the “letters” it has uracil (U). Thus in RNA, A will bind to U. RNA is made from the template DNA strand and is complementary.

DNA20vs20RNA
Comparing DNA and RNA 2

So taking our example,

ATTGTTCGGGATTCTTCGAAATGG

The complementary RNA strand would look like this,

UAACAAGCCCUAAGAAGCUUUACC

Once the RNA strand has been synthesized, it will be used as template to make proteins. In order to make proteins, RNA is read by another molecule (called the ribosome) that will make “words” out of the letters of RNA.

Our example RNA molecule will be read three letters at a time (commonly called codons)

UAA CAA GCC CUA AGA AGC UUU ACC

These codons then are used as a guide to make protein. Every protein is made up of 20 components called amino acids. The 3 letter words above will thus code for an amino acid to make protein (note; there have been a few other amino acids discovered, but are extremely rare and will not be discussed today). These 20 amino acids will then fold together to make complex and specific protein structures. 

protein_-_primary_structure
An example of a small chain of amino acids 3

UAA CAA GCC CUA AGA AGC UUU ACC

UAA= Phenylalanine

CAA= Glutamine

GCC= Alanine

CUA= Leucine

AGA= Arginine

AGC= Serine

UUU= Phenylalanine

ACC= Threonine

Looking at the example above, we see that there are 2 codons that encode for the same amino acid. This is due to the amount of possible codons and amino acids. As mentioned, there are 20 different amino acids. With the four letters of DNA and RNA, there are 64 possible codons. Thus, multiple codons can correlate to the same amino acid in the code.

Now to our news item!

Scientists have recently been able to add two more letters into the genetic code.

Why would it be beneficial to add letters to the genetic alphabet? Going back to our book analogy, imagine if the english alphabet received an additional two letters. These letters can in turn add thousands and thousands of word to our language. These words in turn can be used in stories you read….or blog posts.

In the genetic book, adding new bases allows us to incorporate synthetic amino acids (not found in nature). Now rather than being stuck with 64 different codons, with two more bases, we now have 216 (over 3 times the amount) of codons to work with, each being able to potentially incorporate new amino acids.

This will allow us to change the structure of proteins and how they function, and thus change gene expression.

The research done by these scientists included modifying a famous protein, dubbed green fluorescent protein (GFP for short), a protein that glows a bright green color.

green-fluorescent-protein-molecule-laguna-design
A 3-D representation of GFP 4

While the alterations made to the gene did not directly affect the function of the protein, this is just the beginning of altering our code in a new way to fight diseases and unlock more clues about the evolution of life.

It is very exciting to be at the forefront of this research. We are sure that in the upcoming months more will be revealed and utilized with this technique.The Copernicus Called crew is excited to read and share more as the research is expanded.

As always, if you have questions or comments, do not hesitate to comment on this blog or email us directly at copernicuscalledblog@gmail.com.

Be sure to follow us on Facebook, Twittter, and Tumblr to keep up with the crew and receive updates when new blogs are published.

As always, remember to be curious and stay mindful!

Written By: Cody Wolf

Sources: 

The background information was supplied from my knowledge during my undergraduate and graduate career. If you have any questions, you can contact me via our email. I would also recommend visiting this page to see descriptive videos on how DNA makes protein. 

  1. Cover Picture Source- http://blogs.timesofisrael.com/ethical-legal-and-social-concerns-with-genetically-modified-human-embryos/
  2. Callaway, Ewen. ‘”Alien’ DNA makes proteins in living cells for the first time.” Nature News. Online. https://www.nature.com/news/alien-dna-makes-proteins-in-living-cells-for-the-first-time-1.23040?WT.ec_id=NEWSDAILY-20171130&utm_source=briefing&utm_medium=email&utm_campaign=20171130
  3. Zhang, Y. et al. Nature http://dx.doi.org/10.1038/nature24659 (2017).

 

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google+ photo

You are commenting using your Google+ account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

w

Connecting to %s