Adding Letters to our Genetic Alphabet

Many of us are aware of DNA, the molecule often nicknamed our “genomic book”. Ever since the structure of DNA has been revealed, scientists have been working 24/7 to understand how it works, and how we can manipulate it.

With today’s technology, more than 60 years after revealing the structure and composition of DNA, we can mutate, add on, or take off sections of our genome and utilize it to our benefit.

Now after years of research, scientists from California have been able to take it one step further by adding letters to the book.

Before we dive into our news item, let’s take a few minutes for some background. If you have knowledge about DNA and how it encodes protein, you can skip this section:

Imagine if you will, the english alphabet (A-Z). Twenty-six letters mixed together can create millions of words. These words then come together to create stories…or blog posts.

Our genomic alphabet is comparatively small. In fact, it only has four letters; A, T, C, and G. Each “letter” is a symbol for molecules. A is Adenine, T is Thymine, C is Cytosine, and G is Guanine (note: RNA replaces thymine with uracil (U), we will not discuss this today). These molecules are commonly called bases.

DNAbases
The Four Bases of DNA (A,T,C,G) 1

These molecules pair up together to make the double stranded DNA helix we all know and love today. The two strands are bound together by bonds between these four bases. A will bind with T, and G will bind with C

These molecules make up your genes. Each gene is a long strand of the four bases, and thus affect the functionality of your gene.

Some of you may be asking, how exactly a gene works. Well, here is a quick introduction.

Take for example a sample gene we have created below

ATTGTTCGGGATTCTTCGAAATGG

This gene is one DNA strand that will eventually turn into a protein. It is proteins that then travel throughout the cell and perform various functions that we think of as genes (eye color, hair color, etc..)

In order for DNA to create a protein, it must first be converted into RNA. RNA is very similar to DNA, with only slight differences between the two. RNA is single stranded rather than double stranded, and rather than having thymine as one of the “letters” it has uracil (U). Thus in RNA, A will bind to U. RNA is made from the template DNA strand and is complementary.

DNA20vs20RNA
Comparing DNA and RNA 2

So taking our example,

ATTGTTCGGGATTCTTCGAAATGG

The complementary RNA strand would look like this,

UAACAAGCCCUAAGAAGCUUUACC

Once the RNA strand has been synthesized, it will be used as template to make proteins. In order to make proteins, RNA is read by another molecule (called the ribosome) that will make “words” out of the letters of RNA.

Our example RNA molecule will be read three letters at a time (commonly called codons)

UAA CAA GCC CUA AGA AGC UUU ACC

These codons then are used as a guide to make protein. Every protein is made up of 20 components called amino acids. The 3 letter words above will thus code for an amino acid to make protein (note; there have been a few other amino acids discovered, but are extremely rare and will not be discussed today). These 20 amino acids will then fold together to make complex and specific protein structures. 

protein_-_primary_structure
An example of a small chain of amino acids 3

UAA CAA GCC CUA AGA AGC UUU ACC

UAA= Phenylalanine

CAA= Glutamine

GCC= Alanine

CUA= Leucine

AGA= Arginine

AGC= Serine

UUU= Phenylalanine

ACC= Threonine

Looking at the example above, we see that there are 2 codons that encode for the same amino acid. This is due to the amount of possible codons and amino acids. As mentioned, there are 20 different amino acids. With the four letters of DNA and RNA, there are 64 possible codons. Thus, multiple codons can correlate to the same amino acid in the code.

Now to our news item!

Scientists have recently been able to add two more letters into the genetic code.

Why would it be beneficial to add letters to the genetic alphabet? Going back to our book analogy, imagine if the english alphabet received an additional two letters. These letters can in turn add thousands and thousands of word to our language. These words in turn can be used in stories you read….or blog posts.

In the genetic book, adding new bases allows us to incorporate synthetic amino acids (not found in nature). Now rather than being stuck with 64 different codons, with two more bases, we now have 216 (over 3 times the amount) of codons to work with, each being able to potentially incorporate new amino acids.

This will allow us to change the structure of proteins and how they function, and thus change gene expression.

The research done by these scientists included modifying a famous protein, dubbed green fluorescent protein (GFP for short), a protein that glows a bright green color.

green-fluorescent-protein-molecule-laguna-design
A 3-D representation of GFP 4

While the alterations made to the gene did not directly affect the function of the protein, this is just the beginning of altering our code in a new way to fight diseases and unlock more clues about the evolution of life.

It is very exciting to be at the forefront of this research. We are sure that in the upcoming months more will be revealed and utilized with this technique.The Copernicus Called crew is excited to read and share more as the research is expanded.

As always, if you have questions or comments, do not hesitate to comment on this blog or email us directly at copernicuscalledblog@gmail.com.

Be sure to follow us on Facebook, Twittter, and Tumblr to keep up with the crew and receive updates when new blogs are published.

As always, remember to be curious and stay mindful!

Written By: Cody Wolf

Sources: 

The background information was supplied from my knowledge during my undergraduate and graduate career. If you have any questions, you can contact me via our email. I would also recommend visiting this page to see descriptive videos on how DNA makes protein. 

  1. Cover Picture Source- http://blogs.timesofisrael.com/ethical-legal-and-social-concerns-with-genetically-modified-human-embryos/
  2. Callaway, Ewen. ‘”Alien’ DNA makes proteins in living cells for the first time.” Nature News. Online. https://www.nature.com/news/alien-dna-makes-proteins-in-living-cells-for-the-first-time-1.23040?WT.ec_id=NEWSDAILY-20171130&utm_source=briefing&utm_medium=email&utm_campaign=20171130
  3. Zhang, Y. et al. Nature http://dx.doi.org/10.1038/nature24659 (2017).

 

Advertisements

Book Review: The Bobiverse Trilogy by Dennis E. Taylor

Recently, I have come across a fiction series known as The Bobiverse Trilogy. As a fan of all things science, I could not resist reading the series. The first book in Bobiverse, We Are Legion, was recommended to me. I was not disappointed. Following is a quick review on the trilogy (no spoilers).

The series revolves around a quirky character known as Bob Johansson, who recently sold his software company for a small fortune. Now with the ability and funds to live a life of relaxation, Bob has little cares in the world.

Part of his new fortune is invested in cryogenics, and has chosen to be frozen upon his death. Unfortunately for Bob, his death occurred more recently than he hoped, getting hit by a car during a sci-fi conference.

Bob awakes a century later, to discover that his brain has been downloaded into a computer. As a corpsicle (term for cryogenically frozen individuals; mix between corpse and popsicle), he has no rights in the new world, and his new purpose is to operate AI probes for interstellar space discovery.

Bob’s probe however, is no ordinary space ship. His task is not only to seek out the mysteries of the universe, but also to generate additional ships during his travels using the resources he finds, and 3-D printers (self replicating).

These ships in turn would be operated by clones of Bob who would then search out other areas of the universe and repeat the process, thus having the potential to discover much more space one probe could do alone.

Of course, Bob is not the only space probe in development. Other countries are working diligently to launch a probe and claim galaxies before anyone else has a chance. And they will not hesitate to destroy Bob in the process.

All three books are immensely entertaining, and difficult to put down. The concept of the series should make any science fiction fan water at the mouth, and the character Bob is hard to dislike. Dennis E. Taylor is a grea

Not only are the book’s suspenseful and interesting, but are hilarious. The books are littered with sci-fi references that provide necessary comedic relief.

The last two books in the series revolve around Bob, his clones, and the shenanigans they get into while discovering the universe. All three books are worth reading, and if you are like me, you will be depressed there are only three in the series. 

I give the series as whole, 4.5 stars out of 5 and will recommend to anyone interested in science fiction.

Thank you for reading! Stay tuned for upcoming blogs, one of which will be discussing the technique of space exploration that was utilized in this fiction series (called Von Neumann Probes)

As always, you can reach us via email directly at copernicuscalledblog@gmail.com, or you can visit with us via Facebook, Twitter, or Tumblr.

Remember to always be curious and stay mindful!

 

Here is a link to Dennis E. Taylor’s website to learn more about him and other books he has written. 

Photo Source: https://www.space.com/23747-earth-radiation-belts-fast-electrons.html

 

 

Chemistry: Learning a New Language

 

Many of us are intimidated by chemistry. For those of us who don’t look at chemistry journals everyday, or examine molecular structures very often,  it can be daunting trying to understand chemical structures. 

Nature recently published a quick guide to establishing consistent rules for drawing molecules and understanding what they mean. If you have a basic understanding for how chemist’s draw structures, you can see Nature’s recommendations for particular structures here.

For the rest of us, we have provided a guide to quickly and efficiently see a structure and understand what it is telling us.

 

Chemical Bonds:

I am sure that many of us are familiar with drawing basic bond structures. For example, when you need to draw a small molecule, you can connect two elements with a line, signifying a bond. For example; Carbon (C) bonding with Hydrogen (H) would look like C-H

If we want to draw a full molecule, we can show the bonding between the elements that would represent a molecule.

Methane, a very simple molecule, has one Carbon atom bound with four Hydrogen atoms, as shown below.  In the simplest of terms, a molecule can be described by a chemical equation. This simply lists what elements are in the molecule, and how many of them there are.  The chemical structure of methane is written as CH4 (meaning one Carbon atom, and four Hydrogen atoms). 

003-methane_formula
Source

The image above is a two-dimensional representation of what methane looks like. The drawing does give us more information that the chemical equation. We now know that that the four Hydrogen atoms each bind to Carbon, but what does the molecule look like in reality?

Chemist’s have spent a long time analyzing how molecules look in a 3-D space, and a more accurate representation of methane is below.

Methane-3d
Source

This representation of methane shows that two hydrogen atoms and the carbon atom are in the same plane as the article you are reading. However, two of the hydrogen atoms are out of plane. The black bar indicates that the hydrogen is sticking out of the page (or computer screen), and the dotted lines indicate that the hydrogen is sticking into the page. This is how chemists commonly draw a 3-D structure of molecules.

With modern advancements, software programs can now show molecules in a slightly different way.

molecule_methane_275

Very similar to the previous figure, we see a three dimensional structure of methane. These computer representations however, are not drawn by chemists, and can become extremely complicated for larger molecules that involve several atoms.

 

Basic Drawing:

Now that we understand how bond are normally represented, we can expand our knowledge of drawing molecules.

For simple molecules with a small amount of atoms, it is easy to draw representations the way we have already explored. However, when you need to draw a structure with several atoms, it can take a significant amount of time.

Take for example, octane. The chemical name for octane is C8H18.

octane
Source

While this structure is still relatively simple, it can take a little bit longer to draw.

Chemists have come up with a way to draw long chains of carbon and hydrogen atoms, by simply drawing zig-zag lines (officially dubbed bond-line structures).

octane kink

Each “kink” and “end” in the molecule, represents a Carbon atom. The lines just as before, still represent bonding. In this case we directly see the bonding between the eight Carbons of the molecule (in chemistry, long strings of Carbon are called the ‘Carbon backbone’)

As already mentioned, Carbon is able to make four bonds with other molecules. When drawing a zig-zag representation, the Hydrogen atoms are omitted from the drawing, even though they are present. For example, looking at the far left of the molecule, we see an end that represents carbon. We also see that this Carbon is bonding with another Carbon, that is represented by the first kink.

The Carbon at the end therefore has 3 more bonds to form. Therefore we can assume that 3 Hydrogen bonds are bound to the terminal Carbon molecule.

The Carbon atom located at the first kink has 2 bonds already formed; one with the terminal Carbon, and one with the Carbon in the next kink. There are still two more bonds for Carbon to form, and we can assume that hydrogen will be binding.

The zig-zag method is extremely common in chemistry journals and texts. While drawing octane by showing each atom may not take an abundant amount of time, with larger complex structures however, this can be a real lifesaver.

 

Complex Structures:

Chlorophyl20B
Source

The figure above (depicting chlorophyll, a molecule that gives leaves their green color) shows all of the rules we discussed above, with a few additives. Looking at the molecule, we see that there are 5 carbon ring structures (again each kink represents a Carbon atom unless replaced by another symbol) and some double bonds (representing two bonds between molecules). We also see a few more elements, such as Oxygen (O), Nitrogen (N), and Magnesium (Mg).

Understanding how chemist’s draw is crucial to understanding their research. Now that you have had a crash course in drawing chemical structures, you should be able to apply this knowledge in chemistry classes, and in reading chemistry papers.

If you have any questions on this topics, or other scientific topics, please feel free to comment below or email us directly at copernicuscalledblog@gmail.com. You can also reach us via social media on Facebook, Twitter, or Tumblr.

Note: The information above primarily came from my own experience in my undergraduate and graduate education. Listed below are links that can provide additional information and videos I find helpful. 

And as usual, remember to always be curious and be mindful!

Written by: Cody Wolf

Additional Sources:

  1. https://www.nature.com/articles/d41586-017-05898-6
  2. https://www.khanacademy.org/science/organic-chemistry/gen-chem-review/bond-line-structures/v/bond-line-structures-new
  3. https://socratic.org/organic-chemistry-1/ways-to-draw-and-represent-molecules/bond-line-notation
  4. https://www.wikihow.com/Draw-Organic-Molecules-in-Bond%E2%80%90Line-Notation
  5. https://www.youtube.com/watch?v=ohA3dMqDOqY
  6. Featured Image source: http://aschoonerofscience.com/drugs/mac-for-3d-molecular-visualisation-apple-makes-drug-design-sexy/attachment/scientist-drawing-molecule-structure/