How A Journalist Overestimated the power of One Sitcom in Society.

Recently, I found an article published on Medium describing how the 1990’s sitcom Friends is responsible for the “downfall of western civilization.”

The whole article seemed to be just a little over the top, so I decided to give a thorough reply on this blog page.

In case you have not seen the article I am referring too, follow this link to give it the quick once over.

And if you are like me, you  were alive in the 1990’s and early 2000’s and you probably owned a TV set. While many other shows were popular during the 1990’s, it’s really hard to ignore the show Friends, a comedy sitcom focused around six quirky friends struggling to establish their lives in New York City.

One of the main characters, Ross Geller, is a scientist.  More specifically, he is a paleontologist who begins the show working at a museum, and later ends up as a professor at a prestigious university.

Throughout the whole series, a whopping 10 seasons, Ross is constantly picked on for his profession and is largely ignored by his friends when discussing his work. These exchanges constantly get a laughter from the studio audience.

David Hopkins, the man behind the original article, claims that this visualization of “picking on the smart people” is what caused the downfall of our civilization and likely contributed to the scientific illiteracy we see in today’s society.

“Yes, my theory is that Friends may have triggered the downfall of western civilization. You might think I’m crazy. But to quote Ross: ‘Oh, am I? Am I? Am I out of my mind? Am I losing my senses?” ”

-David Hopkins, “How a TV Sitcom Triggered the Downfall of Western Civilization.”

I think that is a gross exaggeration. And let me describe to you why.

 

Friends is not the first and not even the worst:

Maybe intellectuals have always been persecuted and shoved in lockers, but something in my gut tells me we’re at a low point — where social media interaction has replaced genuine debate and political discourse, where politicians are judged by whether we’d want to have a beer with them, where scientific consensus is rejected, where scientific research is underfunded, where journalism is drowning in celebrity gossip.”

-David Hopkins, “How a TV Sitcom Triggered the Downfall of Western Civilization.”

The largest issue I see with Mr. Hopkins complaint, is that Friends is not the first show to have a scientific/nerdy guy who was picked on during the show. Do we all remember the show Cheers? I admit, it’s a little old for my generation, but I have seen the show in it’s entirety and this show has two main characters similar to Ross that are ostracized for their intelligence. Anybody remember Diane Chambers, who was constantly picked on the gang at Cheers for her fascination with classical books, plays, and overall interest in learning? Or perhaps Fraiser Crane, the psychologist who was a bore for basically the first two seasons of the show until he became a regular who drank more than he treated patients (and let’s not forget his wife Lillith).

Now sure, Fraiser ended up receiving his own show, but even on his own show him and his brother Niles are picked on constantly for their intelligence and love of the finer things. And let’s not forget the dozens of other shows that constantly bully geeks, nerds, and dorks on mainstream television. Steve Urkel on Family Matters? Lisa Simpson or Milhouse Van Houten on The Simpsons? Carlton on The Fresh Prince of Bel-Air? All of these characters came before Ross was a twinkle in the producer’s eye that invented the character. If anything, the character Ross added to the description of nerds in mainstream media, and was likely developed to be similar to other nerds on other TV shows.

Ross was not alone in his suffering:

 Sure Ross was picked on. Quite a bit actually. But he was not the only main character in the hot seat. Basically every single character was picked on religiously throughout the show. Joey Tribbiani, the lovable aspiring actor, was constantly bullied for his stupidity and by the end of the series was even written to be almost to stupid to be real. Monica was continuously made fun of her obsessive cleaning and organized personality. Chandler, the sarcastic one, was picked on not only for having a job no one could remember, and everyone thought he was secretly gay. The fact of the matter is, at the end of the day every character, even the small characters like Gunther, were picked on for their personality an equal amount. And at the end of the day, it was the diversity of the group that made the group fit so well together. If we want to specifically say Ross’s character contributed to scientific illiteracy or high point in bullying nerds, I think we would learn more evaluating the community as a whole.

2004, a year with coincidences:

Sure it does seem like the end of Friend’s marked the beginning of scientific devastation in our civilization, but it’s really all a coincidence. It’s not good science to automatically correlate events happening within a year together. In 2004, Mr. Hopkins was a teacher who constantly saw bullying of nerds, President Bush was elected for a second term, Paris Hilton was a big deal, etc…..

But what does this really show us? It’s easy to look at any information from one year and make some random conclusion.

For example: I randomly choose the year 1998.

Google was born. Bill Clinton denies he had sexual relations with that woman, and a huge financial crisis hits a large portion of Asia.

Conclusions? Bill Clinton’s lies caused Google to form to prove him wrong, and this causes a financial crisis in Asia.

Now I know this is ridiculous, And I spent about 30 seconds writing that to be as ridiculous as possible, because there is no good reason to look at any year and try to piece information together. Correlation does not always correspond to causation. 

If you look at any year in particular, you can probably fit any narrative you wish to defend your claim, and that is not the purpose of good science. Scientists spend time objectively spending time looking for trends, and then try to find an explanation for them. More importantly they look for other explanations to explain the phenomenon besides their own theories.

 

And finally to sum up my main issue with this whole idea, why should we put all the blame on TV shows? Sure we all watch TV and that has an impact on our lives, but WE are the ones choosing what to watch. If there is anyone to blame, it is ourselves for watching American Idol or The Bachelor over The Discovery Channel and National Geographic. Rather than putting actors and musicians on the pedestal, we should put scientists and inventors in the public eye. We should inherently be more interested in news items that expand our knowledge rather than the celebrity gossip. And this has been a problem looooong before 2004. Just as we shouldn’t blame video games on increasing school shootings, we shouldn’t blame TV for stupefying civilization, we should blame ourselves.

So Mr. Hopkins, I think we are trying to say the same thing. But this issue is much larger than one sitcom. It’s the society in general.

And here are the suggestions I have to improve our society.

Think Critically: 

Stop believing everything people tell you. Question as much as you possibly can. Even your professors or teachers, because more than likely they are wrong about something (not always on purpose).

Don’t Enter an Echo Chamber: 

It is extremely easy on the internet to find sources that on the surface appear legit, but below end up being complete garbage. If you are looking to prove something you believe in, don’t just look for sites that confirm your suspicion. Spend just as much time looking at the other side of the argument and hear what they have to say. If you spend your whole life only reading articles that support your belief system, you are entering into an echo chamber that can in the long run harm the knowledge you have developed.

Be Willing to Change your Opinion:

People are wrong all the time, myself especially. And this is extremely hard to get used to, but stop being bothered by being wrong. It happens. Rather than digging yourself into a faulty belief, say “Oh yeah, I am wrong, I need to change my opinion.” There is absolutely nothing wrong with that.

Dear God Yes Read a Book: 

Mr. Hopkins said it well. Reading a book rather than watching TV is a great way to expand your knowledge, whether it’s fiction or non-fiction. Read books that question your deepest belief system. You cannot limit your books to your safety zone, it is much more harmful than it is helpful.

Have a Scout Mindset: 

I think it’s safe to say that all of us are curious. But some of us inherently are more curious or more interested in feeding our curiosity than others. So the next time you wonder why the sky is blue, don’t just think about it for 30 seconds, look it up. If you can’t find an answer that makes sense, keep digging until it does make sense. You will learn so much. Basically look for THE answer, not YOUR answer.

P.S. If you do not know what a scout mindset is, check out this wonderful Ted Talk.

So the next time you binge watch Friends on Netflix, don’t feel so bad for Ross.

 

 

 

 

 

 

 

Advertisements

Learning About Exoplanets

For generations, people have always wondered what life might exist in the universe besides ours. It has become a hot topic in movies, books, and of course, science.

Before even reaching space, humans have always hypothesized about “The Great Beyond” So far we have not found alternative life, but we have made significant progress. 

On major discovery is exoplanets. It seems pretty obvious that extraterrestrial life must exist on another planet, however before we can find life, we must find planets that can support it. 

An exoplanet by definition is a planet outside our solar system that orbits a star(1). The first scientific detection of an exoplanet was in 1988, although we have hypothesized the existence of exoplanets for over 100 years. 

Although we know have the technology to find exoplanets semi-regularly (the current number of known planets is almost 4,000), scientists are looking for planets in what is called the habitable zone (also called the Goldilocks zone). This arbitrary zone describes planets that are just far enough from their sun to support liquid water, but not too far to cause it to freeze. 

1920px-Diagram_of_different_habitable_zone_regions_by_Chester_Harman
An example of the habitable zone and a few exoplanets that exist within a habitable zone. Source

Of course, it takes more than possessing water to host life on a planet. Since, we only have one example to go off of, scientists are looking for planets most similar to our own. As of now there is an estimated 40 billion planets Earth-sized and orbiting the habitable zone of stars we have yet to discover(2). It’s these planets that we are most interested in.

In fact, recently a group of scientists met and explained how water should not be the only candidate for a planet within the habitable zone able to host liquid water. Certain geological structures are necessary to allow growth of organisms and proper collection of minerals that can give life a better chance (4).

With new discoveries and scientific advancements, researchers are also trying to unravel the mysteries of exoplanet geology. 

The research even has a name. Exogeology. This area brings together scientists from the field of astronomy, planetary scientists, and geologists together with the task to reveal what exoplanets look like from a geological perspective(3).

One of the best tools we have to decipher exoplanet surfaces, called the Z machine, has just begun scratching the surface in exploring exoplanet material. 

This machine is currently the largest high frequency electromagnetic wave generator, and its purpose within this context is to test various materials under extreme temperature and pressure  (5).

While we are not able to travel to exoplanets yet, we are now working to understand them as best as possible by working to create artificial environments we would normally see to try and discern how exoplanets behave.  

With more information, we can better understand exoplanets, and focus our attentions on those with the best chances of other beings. Perhaps one of them may write a blog with us someday.

As always, be sure to leave a comment with any questions. You can also reach us on Facebook, Twitter, and Tumblr.

Remember to be curious, and stay mindful!

Written By: Cody Wolf 

Sources:

  1. https://en.wikipedia.org/wiki/Exoplanet
  2. https://en.wikipedia.org/wiki/List_of_potentially_habitable_exoplanets
  3. https://www.nature.com/articles/d41586-017-07844-y
  4. http://www.nature.com/news/exoplanet-hunters-rethink-search-for-alien-life-1.23023
  5. https://en.wikipedia.org/wiki/Z_Pulsed_Power_Facility

Featured Image: https://wallpapercave.com/cool-planet-backgrounds

Making Art With DNA

Since the 1980’s, scientists have been making shapes out of DNA. In recent years, technological advances have increased to the point where we can now make beautiful designs from the molecule that encodes our existence. It’s called DNA Origami.

The idea is relatively simple. A single strand of a DNA molecule is used as a scaffold. The scaffold is then molded to design the shape desired with “staple molecules” or short complementary sequences of DNA that will fold the scaffold strand.

2_1
An example of Scaffold and Staple DNA construction. Source

With the right computer programs, you can make a wide variety of shapes, including smiley faces, teddy bears, or even a box equipped with a lid and a lock.

Of course, it’s always fun when scientists get to play around, but there are some pretty impressive applications to this technique as well.

Scientists have been adapting DNA origami to form various objects (a sphere, or a box) able to carry drugs to a target site within the body. For example, chemotherapy and immunotherapy drugs for cancer patients wreak havoc on the body. However, if they are able to be transferred to the tumor itself, not only would you have reduced toxicity, you would also potentially increase your chance of destroying the tumor.

2016_SL_Origami_twosmileys
An example of various shapes that can be made with DNA origami. Source

Others have also worked to create “nanobots” (extremely small functional robots) from DNA. These nanobots reportedly have the capability of being pre-programmed to travel to certain areas and perform basic functions. While the technology is very new and has not been tested in humans yet, it appears to be a promising avenue of research.

While DNA origami technology has come a long way, scientists have been limited on one aspect; size.

Currently, the largest a DNA origami shape could be is about 100 nanometers. If larger than that, the shapes loose their stability.

Yesterday however, four papers published in Nature describes methods of evading this problem.

origamiexamples
DNA Origami box. Source

By creating small DNA origami V-shaped structures and allowing them to link together, scientists have overcome the size restrains. These structures can then be used to make large, stable structures like the sphere below.

nature origami 1
A representation of the DNA V building blocks. Source

These larger spheres then possess the capability of carrying a wide variety of items, including drugs for various diseases.

 

Researchers also developed a new design software that can generate pictures and make DNA origami representations of pictures, like the Mona Lisa for example.

 

 

nature origami 2
Representations of the size of molecules able to be generated with new DNA origami techniques. Source

Another complicating aspect to DNA origami is price. Creating the proper strands to make these complex structures takes a lot of time, and a lot of resources. One way to overcome the price is to develop a long single stranded DNA molecule that possess not only the staple and scaffold strands, but also section able to break apart the other sections of the same molecule (called a DNAzyme). This one strand will therefore be able to cleave the scaffold and staple strands from itself and be able to make the structure, thus decreasing the cost.

 

The advancement of creating DNA structures has been fascinating to watch the last decade, and with these new advancements, DNA origami technology will quickly become a pioneer technique in a variety of scientific fields.

As always, if you have questions, please comment below or email us directly at copernicuscalledblog@gmail.com.

You can also reach us on our various social media outlets, including Facebook, Twitter, and Tumblr.

Sources:

  1. Service, Robert F., Scientists shape DNA into doughnuts, teddy bears, and an image of the Mona Lisa. Science. http://www.sciencemag.org/news/2017/12/scientists-shape-dna-doughnuts-teddy-bears-and-image-mona-lisa
  2. Zhang, Fei, Yan, Hao. DNA self-assembly scaled up. Nature. https://www.nature.com/articles/d41586-017-07690-y#ref-CR2
  3. https://www.nature.com/articles/d41586-017-07690-y#ref-CR2
  4. Wagenbauer, K. F. et al. Nature 552, 78–83 (2017)
  5. Tikhomirov, G. et al. Nature 552, 67–71 (2017).
  6. Featured image- https://www.yourgenome.org/activities/origami-dna

 

 

 

 

 

 

 

 

Teenage Nutrition Study Goes Wrong

In research, it is crucial to not only ensure that data collected is meaningful and sound, but also that subjects (whether it be animals or humans) are treated properly.

Recent stories have been released in regards to a nutrition study from researchers at Purdue University that highlight examples of what not to do in a scientific study.

The purpose of the study was to evaluate the effects of low sodium diets on adolescent children with high blood pressure. Children were signed up for a seven week trial over a summer that placed them in campus housing. The project was dubbed Camp DASH, an abbreviation for Dietary Approaches to Stop Hypertension(1,2).

Everything went awry after a video of one of the girl participants showering appeared on social media. The police were notified and other accusations arose involving additional children within the study.

It appears from the start, the study was inadequate in planning, and was not fully prepared for hosting the adolescent children.

Within the first week of the study, it was reported that two participants were arrested due to violence among the adolescent children. Injuries were severe enough warrant a hospital visit for one of the participants. Both of the children were removed from the study, but this highlights the first of many faults in this study; lack of proper supervision(1,2)

Just one week after the two were dismissed, another accusation arose involving one male participant sexually harassing several of the female participants. The male was ejected from the study, but the harassment was not reported to necessary university personnel.(1)

During an unsupervised sauna session, a male reportedly burned another male participant with a hot rock that left second degree burns(1,2)

These are just a few examples of the many incidences that occurred during the time of the study.

The principal investigator of Camp DASH, Dr. Connie Weaver, has been brought under scrutiny for the research, and from the reports, it appears to be just.

Dr. Weaver was notified throughout the entire study of the misconduct going on, and did not make the proper corrections to ensure the safety of the children within the study(1)

In a statement released earlier this week, Dr. Weaver commented on allegations arising from the study.

“I am deeply saddened by the instances that caused Camp DASH to end early. As the principal investigator, I accept responsibility for events that occurred at Camp DASH. The safety and security of research participants always comes first.” (3)

Not only were the accusations hidden, but personnel staff were not properly screened before beginning the study.

Every hired member of the camp  were required to undergo a detailed background check. Only seven of the 132 members were screened (2). Furthermore, each member on the staff was required to complete online training before the study began. Thirteen percent of staff members did not complete the training, including the Camp Manager, who did not complete his training until the day he was terminated.

As a result of the problems within the study, the university ended it two weeks prior to its scheduled completion date, and all of the data generated from the study was discarded.

This is a perfect example of research misconduct during human trials. Not only did the principal investigator overlook accusations, she did fulfill the duties of keeping the subjects safe that were specifically written during her proposal.

This neglect thus resulted in directly wasting 8.8 million dollars from the NIH (federal funding source), and placing over 70 adolescent children in an environment leading to violence and sexual harassment(2).

While the principal investigator and university staff overseeing Camp DASH have not been directly reprimanded, we expect more news to be released as the story develops.

Be sure to look for our updates as news continues.

 

We recommend that if you are interested, to read this detailed report written by Alysa Rollock, the Vice President for Ethics and Compliance at Purdue University.

As always, if you have any questions or comments, feel free to comment below or email us directly at copernicuscalledlblog@gmail.com

 

You can also reach us on Facebook, Twitter, and Tumblr.

 

Written By: Cody Wolf

Sources

  1. Rollock, Alysa. “Report on Review and Assessment of Purdue University’s Actions in Connection with the Camp DASH Research Study. Accessed online 12/1/2017. https://www.purdue.edu/newsroom/documents/campdash-report.pdf

 

  1. Gastelum, Amy. “Purdue University Mounted a Child Nutrition Study. It Went Very, Very Wrong.” Undark.org. https://undark.org/article/purdue-camp-dash-nutrition-weaver/

 

  1. Menchaca, Mateo. “Purdue review board throws out Camp DASH data.” The Exponent. https://www.purdueexponent.org/campus/article_5ec9584b-1565-502d-a6f5-f49498411138.html

Adding Letters to our Genetic Alphabet

Many of us are aware of DNA, the molecule often nicknamed our “genomic book”. Ever since the structure of DNA has been revealed, scientists have been working 24/7 to understand how it works, and how we can manipulate it.

With today’s technology, more than 60 years after revealing the structure and composition of DNA, we can mutate, add on, or take off sections of our genome and utilize it to our benefit.

Now after years of research, scientists from California have been able to take it one step further by adding letters to the book.

Before we dive into our news item, let’s take a few minutes for some background. If you have knowledge about DNA and how it encodes protein, you can skip this section:

Imagine if you will, the english alphabet (A-Z). Twenty-six letters mixed together can create millions of words. These words then come together to create stories…or blog posts.

Our genomic alphabet is comparatively small. In fact, it only has four letters; A, T, C, and G. Each “letter” is a symbol for molecules. A is Adenine, T is Thymine, C is Cytosine, and G is Guanine (note: RNA replaces thymine with uracil (U), we will not discuss this today). These molecules are commonly called bases.

DNAbases
The Four Bases of DNA (A,T,C,G) 1

These molecules pair up together to make the double stranded DNA helix we all know and love today. The two strands are bound together by bonds between these four bases. A will bind with T, and G will bind with C

These molecules make up your genes. Each gene is a long strand of the four bases, and thus affect the functionality of your gene.

Some of you may be asking, how exactly a gene works. Well, here is a quick introduction.

Take for example a sample gene we have created below

ATTGTTCGGGATTCTTCGAAATGG

This gene is one DNA strand that will eventually turn into a protein. It is proteins that then travel throughout the cell and perform various functions that we think of as genes (eye color, hair color, etc..)

In order for DNA to create a protein, it must first be converted into RNA. RNA is very similar to DNA, with only slight differences between the two. RNA is single stranded rather than double stranded, and rather than having thymine as one of the “letters” it has uracil (U). Thus in RNA, A will bind to U. RNA is made from the template DNA strand and is complementary.

DNA20vs20RNA
Comparing DNA and RNA 2

So taking our example,

ATTGTTCGGGATTCTTCGAAATGG

The complementary RNA strand would look like this,

UAACAAGCCCUAAGAAGCUUUACC

Once the RNA strand has been synthesized, it will be used as template to make proteins. In order to make proteins, RNA is read by another molecule (called the ribosome) that will make “words” out of the letters of RNA.

Our example RNA molecule will be read three letters at a time (commonly called codons)

UAA CAA GCC CUA AGA AGC UUU ACC

These codons then are used as a guide to make protein. Every protein is made up of 20 components called amino acids. The 3 letter words above will thus code for an amino acid to make protein (note; there have been a few other amino acids discovered, but are extremely rare and will not be discussed today). These 20 amino acids will then fold together to make complex and specific protein structures. 

protein_-_primary_structure
An example of a small chain of amino acids 3

UAA CAA GCC CUA AGA AGC UUU ACC

UAA= Phenylalanine

CAA= Glutamine

GCC= Alanine

CUA= Leucine

AGA= Arginine

AGC= Serine

UUU= Phenylalanine

ACC= Threonine

Looking at the example above, we see that there are 2 codons that encode for the same amino acid. This is due to the amount of possible codons and amino acids. As mentioned, there are 20 different amino acids. With the four letters of DNA and RNA, there are 64 possible codons. Thus, multiple codons can correlate to the same amino acid in the code.

Now to our news item!

Scientists have recently been able to add two more letters into the genetic code.

Why would it be beneficial to add letters to the genetic alphabet? Going back to our book analogy, imagine if the english alphabet received an additional two letters. These letters can in turn add thousands and thousands of word to our language. These words in turn can be used in stories you read….or blog posts.

In the genetic book, adding new bases allows us to incorporate synthetic amino acids (not found in nature). Now rather than being stuck with 64 different codons, with two more bases, we now have 216 (over 3 times the amount) of codons to work with, each being able to potentially incorporate new amino acids.

This will allow us to change the structure of proteins and how they function, and thus change gene expression.

The research done by these scientists included modifying a famous protein, dubbed green fluorescent protein (GFP for short), a protein that glows a bright green color.

green-fluorescent-protein-molecule-laguna-design
A 3-D representation of GFP 4

While the alterations made to the gene did not directly affect the function of the protein, this is just the beginning of altering our code in a new way to fight diseases and unlock more clues about the evolution of life.

It is very exciting to be at the forefront of this research. We are sure that in the upcoming months more will be revealed and utilized with this technique.The Copernicus Called crew is excited to read and share more as the research is expanded.

As always, if you have questions or comments, do not hesitate to comment on this blog or email us directly at copernicuscalledblog@gmail.com.

Be sure to follow us on Facebook, Twittter, and Tumblr to keep up with the crew and receive updates when new blogs are published.

As always, remember to be curious and stay mindful!

Written By: Cody Wolf

Sources: 

The background information was supplied from my knowledge during my undergraduate and graduate career. If you have any questions, you can contact me via our email. I would also recommend visiting this page to see descriptive videos on how DNA makes protein. 

  1. Cover Picture Source- http://blogs.timesofisrael.com/ethical-legal-and-social-concerns-with-genetically-modified-human-embryos/
  2. Callaway, Ewen. ‘”Alien’ DNA makes proteins in living cells for the first time.” Nature News. Online. https://www.nature.com/news/alien-dna-makes-proteins-in-living-cells-for-the-first-time-1.23040?WT.ec_id=NEWSDAILY-20171130&utm_source=briefing&utm_medium=email&utm_campaign=20171130
  3. Zhang, Y. et al. Nature http://dx.doi.org/10.1038/nature24659 (2017).

 

Book Review: The Bobiverse Trilogy by Dennis E. Taylor

Recently, I have come across a fiction series known as The Bobiverse Trilogy. As a fan of all things science, I could not resist reading the series. The first book in Bobiverse, We Are Legion, was recommended to me. I was not disappointed. Following is a quick review on the trilogy (no spoilers).

The series revolves around a quirky character known as Bob Johansson, who recently sold his software company for a small fortune. Now with the ability and funds to live a life of relaxation, Bob has little cares in the world.

Part of his new fortune is invested in cryogenics, and has chosen to be frozen upon his death. Unfortunately for Bob, his death occurred more recently than he hoped, getting hit by a car during a sci-fi conference.

Bob awakes a century later, to discover that his brain has been downloaded into a computer. As a corpsicle (term for cryogenically frozen individuals; mix between corpse and popsicle), he has no rights in the new world, and his new purpose is to operate AI probes for interstellar space discovery.

Bob’s probe however, is no ordinary space ship. His task is not only to seek out the mysteries of the universe, but also to generate additional ships during his travels using the resources he finds, and 3-D printers (self replicating).

These ships in turn would be operated by clones of Bob who would then search out other areas of the universe and repeat the process, thus having the potential to discover much more space one probe could do alone.

Of course, Bob is not the only space probe in development. Other countries are working diligently to launch a probe and claim galaxies before anyone else has a chance. And they will not hesitate to destroy Bob in the process.

All three books are immensely entertaining, and difficult to put down. The concept of the series should make any science fiction fan water at the mouth, and the character Bob is hard to dislike. Dennis E. Taylor is a grea

Not only are the book’s suspenseful and interesting, but are hilarious. The books are littered with sci-fi references that provide necessary comedic relief.

The last two books in the series revolve around Bob, his clones, and the shenanigans they get into while discovering the universe. All three books are worth reading, and if you are like me, you will be depressed there are only three in the series. 

I give the series as whole, 4.5 stars out of 5 and will recommend to anyone interested in science fiction.

Thank you for reading! Stay tuned for upcoming blogs, one of which will be discussing the technique of space exploration that was utilized in this fiction series (called Von Neumann Probes)

As always, you can reach us via email directly at copernicuscalledblog@gmail.com, or you can visit with us via Facebook, Twitter, or Tumblr.

Remember to always be curious and stay mindful!

 

Here is a link to Dennis E. Taylor’s website to learn more about him and other books he has written. 

Photo Source: https://www.space.com/23747-earth-radiation-belts-fast-electrons.html

 

 

Chemistry: Learning a New Language

 

Many of us are intimidated by chemistry. For those of us who don’t look at chemistry journals everyday, or examine molecular structures very often,  it can be daunting trying to understand chemical structures. 

Nature recently published a quick guide to establishing consistent rules for drawing molecules and understanding what they mean. If you have a basic understanding for how chemist’s draw structures, you can see Nature’s recommendations for particular structures here.

For the rest of us, we have provided a guide to quickly and efficiently see a structure and understand what it is telling us.

 

Chemical Bonds:

I am sure that many of us are familiar with drawing basic bond structures. For example, when you need to draw a small molecule, you can connect two elements with a line, signifying a bond. For example; Carbon (C) bonding with Hydrogen (H) would look like C-H

If we want to draw a full molecule, we can show the bonding between the elements that would represent a molecule.

Methane, a very simple molecule, has one Carbon atom bound with four Hydrogen atoms, as shown below.  In the simplest of terms, a molecule can be described by a chemical equation. This simply lists what elements are in the molecule, and how many of them there are.  The chemical structure of methane is written as CH4 (meaning one Carbon atom, and four Hydrogen atoms). 

003-methane_formula
Source

The image above is a two-dimensional representation of what methane looks like. The drawing does give us more information that the chemical equation. We now know that that the four Hydrogen atoms each bind to Carbon, but what does the molecule look like in reality?

Chemist’s have spent a long time analyzing how molecules look in a 3-D space, and a more accurate representation of methane is below.

Methane-3d
Source

This representation of methane shows that two hydrogen atoms and the carbon atom are in the same plane as the article you are reading. However, two of the hydrogen atoms are out of plane. The black bar indicates that the hydrogen is sticking out of the page (or computer screen), and the dotted lines indicate that the hydrogen is sticking into the page. This is how chemists commonly draw a 3-D structure of molecules.

With modern advancements, software programs can now show molecules in a slightly different way.

molecule_methane_275

Very similar to the previous figure, we see a three dimensional structure of methane. These computer representations however, are not drawn by chemists, and can become extremely complicated for larger molecules that involve several atoms.

 

Basic Drawing:

Now that we understand how bond are normally represented, we can expand our knowledge of drawing molecules.

For simple molecules with a small amount of atoms, it is easy to draw representations the way we have already explored. However, when you need to draw a structure with several atoms, it can take a significant amount of time.

Take for example, octane. The chemical name for octane is C8H18.

octane
Source

While this structure is still relatively simple, it can take a little bit longer to draw.

Chemists have come up with a way to draw long chains of carbon and hydrogen atoms, by simply drawing zig-zag lines (officially dubbed bond-line structures).

octane kink

Each “kink” and “end” in the molecule, represents a Carbon atom. The lines just as before, still represent bonding. In this case we directly see the bonding between the eight Carbons of the molecule (in chemistry, long strings of Carbon are called the ‘Carbon backbone’)

As already mentioned, Carbon is able to make four bonds with other molecules. When drawing a zig-zag representation, the Hydrogen atoms are omitted from the drawing, even though they are present. For example, looking at the far left of the molecule, we see an end that represents carbon. We also see that this Carbon is bonding with another Carbon, that is represented by the first kink.

The Carbon at the end therefore has 3 more bonds to form. Therefore we can assume that 3 Hydrogen bonds are bound to the terminal Carbon molecule.

The Carbon atom located at the first kink has 2 bonds already formed; one with the terminal Carbon, and one with the Carbon in the next kink. There are still two more bonds for Carbon to form, and we can assume that hydrogen will be binding.

The zig-zag method is extremely common in chemistry journals and texts. While drawing octane by showing each atom may not take an abundant amount of time, with larger complex structures however, this can be a real lifesaver.

 

Complex Structures:

Chlorophyl20B
Source

The figure above (depicting chlorophyll, a molecule that gives leaves their green color) shows all of the rules we discussed above, with a few additives. Looking at the molecule, we see that there are 5 carbon ring structures (again each kink represents a Carbon atom unless replaced by another symbol) and some double bonds (representing two bonds between molecules). We also see a few more elements, such as Oxygen (O), Nitrogen (N), and Magnesium (Mg).

Understanding how chemist’s draw is crucial to understanding their research. Now that you have had a crash course in drawing chemical structures, you should be able to apply this knowledge in chemistry classes, and in reading chemistry papers.

If you have any questions on this topics, or other scientific topics, please feel free to comment below or email us directly at copernicuscalledblog@gmail.com. You can also reach us via social media on Facebook, Twitter, or Tumblr.

Note: The information above primarily came from my own experience in my undergraduate and graduate education. Listed below are links that can provide additional information and videos I find helpful. 

And as usual, remember to always be curious and be mindful!

Written by: Cody Wolf

Additional Sources:

  1. https://www.nature.com/articles/d41586-017-05898-6
  2. https://www.khanacademy.org/science/organic-chemistry/gen-chem-review/bond-line-structures/v/bond-line-structures-new
  3. https://socratic.org/organic-chemistry-1/ways-to-draw-and-represent-molecules/bond-line-notation
  4. https://www.wikihow.com/Draw-Organic-Molecules-in-Bond%E2%80%90Line-Notation
  5. https://www.youtube.com/watch?v=ohA3dMqDOqY
  6. Featured Image source: http://aschoonerofscience.com/drugs/mac-for-3d-molecular-visualisation-apple-makes-drug-design-sexy/attachment/scientist-drawing-molecule-structure/